Incidental Mutation 'R6778:Rdh10'
ID531356
Institutional Source Beutler Lab
Gene Symbol Rdh10
Ensembl Gene ENSMUSG00000025921
Gene Nameretinol dehydrogenase 10 (all-trans)
Synonyms3110069K09Rik, D1Ertd762e, 4921506A21Rik, m366Asp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R6778 (G1)
Quality Score84.0076
Status Not validated
Chromosome1
Chromosomal Location16105774-16133734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16106184 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 56 (F56S)
Ref Sequence ENSEMBL: ENSMUSP00000027053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027053] [ENSMUST00000058437]
Predicted Effect probably damaging
Transcript: ENSMUST00000027053
AA Change: F56S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027053
Gene: ENSMUSG00000025921
AA Change: F56S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:KR 37 231 3.1e-8 PFAM
Pfam:adh_short 90 259 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058437
SMART Domains Protein: ENSMUSP00000071616
Gene: ENSMUSG00000043716

DomainStartEndE-ValueType
Pfam:Ribosomal_L30_N 39 109 4.5e-31 PFAM
Pfam:Ribosomal_L30 112 162 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149566
SMART Domains Protein: ENSMUSP00000118695
Gene: ENSMUSG00000043716

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Pfam:Ribosomal_L30_N 65 135 2.1e-31 PFAM
Pfam:Ribosomal_L30 138 188 3e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinol dehydrogenase, which converts all-trans-retinol to all-trans-retinal, with preference for NADP as a cofactor. Studies in mice suggest that this protein is essential for synthesis of embryonic retinoic acid and is required for limb, craniofacial, and organ development. [provided by RefSeq, Dec 2011]
PHENOTYPE: Embryos homozygous for null or hypomorphic alleles exhibit mid-gestational lethality, reduced Retinoic Acid signaling and abnormal limb, craniofacial, somite and cardiac morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T A 10: 61,225,452 N403Y probably damaging Het
Akap6 A G 12: 53,025,816 E989G probably damaging Het
Aoc2 A G 11: 101,325,361 N90S probably damaging Het
Apol9a T C 15: 77,404,333 Y278C probably benign Het
Casq2 T A 3: 102,127,931 probably null Het
Ccdc7a T A 8: 128,821,120 T1284S possibly damaging Het
Dlat A G 9: 50,650,857 L289P probably damaging Het
Dnah8 C T 17: 30,635,666 P101S probably benign Het
Dzip3 C A 16: 48,982,083 A28S probably benign Het
Fam205c T C 4: 42,868,522 K367R possibly damaging Het
Ffar4 A G 19: 38,113,664 E249G possibly damaging Het
Fubp3 A T 2: 31,598,673 K180N possibly damaging Het
Gm7489 T A 15: 53,885,952 probably benign Het
Ifitm6 A T 7: 141,016,143 M59K possibly damaging Het
Igkv4-80 A T 6: 69,016,561 Y115* probably null Het
Igsf21 G T 4: 140,034,648 R240S probably benign Het
Kank4 A T 4: 98,761,505 N942K probably benign Het
Man2a1 C A 17: 64,714,635 T35K possibly damaging Het
Mvk T A 5: 114,452,380 D193E probably benign Het
Npas2 T A 1: 39,325,300 M241K possibly damaging Het
Npsr1 T A 9: 24,254,618 I100N possibly damaging Het
Olfml2b A G 1: 170,645,070 D50G probably damaging Het
Olfr961 T A 9: 39,646,747 V7E probably damaging Het
Pcnx A G 12: 81,918,871 D604G probably damaging Het
Pitx2 C T 3: 129,218,743 P254L probably damaging Het
Rin1 T C 19: 5,054,886 L647P probably damaging Het
Sgk3 T A 1: 9,886,144 probably null Het
Sgpp1 A G 12: 75,716,294 I371T probably benign Het
Slc12a9 T C 5: 137,315,081 Y872C possibly damaging Het
Syne1 A G 10: 5,102,406 F7487L probably damaging Het
Tars T C 15: 11,389,699 N375S probably benign Het
Tbc1d31 A G 15: 57,938,029 Y320C probably damaging Het
Tbl1xr1 T A 3: 22,189,782 F73L probably benign Het
Tmem145 G A 7: 25,311,376 V378I probably benign Het
Tmprss11d T C 5: 86,309,350 H150R probably benign Het
Tnc T G 4: 63,995,598 I1326L probably benign Het
Trpc7 T C 13: 56,804,687 Y502C probably damaging Het
Usp32 T C 11: 85,025,686 I811V probably benign Het
Vmn1r71 C T 7: 10,748,216 A182T probably benign Het
Wdr47 T A 3: 108,633,096 N602K probably benign Het
Other mutations in Rdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Rdh10 APN 1 16107875 missense probably benign
IGL01646:Rdh10 APN 1 16108022 missense possibly damaging 0.90
IGL01820:Rdh10 APN 1 16128259 missense possibly damaging 0.84
IGL02377:Rdh10 APN 1 16106214 nonsense probably null
IGL03212:Rdh10 APN 1 16107827 missense probably benign 0.03
R0039:Rdh10 UTSW 1 16129284 missense probably damaging 0.97
R0042:Rdh10 UTSW 1 16108036 unclassified probably benign
R0042:Rdh10 UTSW 1 16108036 unclassified probably benign
R0109:Rdh10 UTSW 1 16106265 missense probably damaging 0.97
R0569:Rdh10 UTSW 1 16129293 missense probably damaging 1.00
R1272:Rdh10 UTSW 1 16108016 missense probably damaging 1.00
R1633:Rdh10 UTSW 1 16128196 missense possibly damaging 0.90
R2896:Rdh10 UTSW 1 16106105 splice site probably null
R4623:Rdh10 UTSW 1 16131063 splice site probably benign
R5095:Rdh10 UTSW 1 16131385 missense probably benign 0.01
R5158:Rdh10 UTSW 1 16107997 missense probably damaging 1.00
R5535:Rdh10 UTSW 1 16131184 missense probably damaging 1.00
R6433:Rdh10 UTSW 1 16107855 missense probably damaging 0.98
R6922:Rdh10 UTSW 1 16106031 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTGACAACTCCCGCGTC -3'
(R):5'- ACTAGGCAGTGGAGACCCTC -3'

Sequencing Primer
(F):5'- TAACTCGCGGCTGTCACC -3'
(R):5'- TCCGGGCTGGGGAGATG -3'
Posted On2018-08-29