Incidental Mutation 'R7044:Snapc4'
ID547194
Institutional Source Beutler Lab
Gene Symbol Snapc4
Ensembl Gene ENSMUSG00000036281
Gene Namesmall nuclear RNA activating complex, polypeptide 4
Synonyms5730436L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location26362765-26380653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26369953 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 495 (S495P)
Ref Sequence ENSEMBL: ENSMUSP00000109750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035427] [ENSMUST00000114115]
Predicted Effect probably damaging
Transcript: ENSMUST00000035427
AA Change: S487P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281
AA Change: S487P

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114115
AA Change: S495P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281
AA Change: S495P

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122456
Gene: ENSMUSG00000036281
AA Change: S188P

DomainStartEndE-ValueType
SANT 47 99 3.05e-9 SMART
SANT 102 151 8.24e-15 SMART
SANT 154 203 7.8e-16 SMART
low complexity region 218 249 N/A INTRINSIC
Meta Mutation Damage Score 0.2707 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of the small nuclear RNA-activating protein (SNAP) complex. The encoded protein contains a Myb DNA-binding domain, and is essential for RNA polymerase II and III polymerase transcription from small nuclear RNA promoters. A mutation in this gene is associated with ankylosing spondylitis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Mfge8 A G 7: 79,142,520 V219A probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Snapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Snapc4 APN 2 26369312 missense probably benign
IGL01730:Snapc4 APN 2 26363724 unclassified probably null
IGL01958:Snapc4 APN 2 26366440 unclassified probably benign
IGL02354:Snapc4 APN 2 26367307 unclassified probably benign
IGL02425:Snapc4 APN 2 26368200 missense probably damaging 1.00
IGL02812:Snapc4 APN 2 26369372 missense probably benign 0.03
IGL02951:Snapc4 APN 2 26370835 missense probably benign 0.33
R0011:Snapc4 UTSW 2 26364813 missense probably benign 0.03
R0409:Snapc4 UTSW 2 26367216 missense probably benign 0.37
R0932:Snapc4 UTSW 2 26374646 missense probably damaging 1.00
R1674:Snapc4 UTSW 2 26376197 missense probably benign
R1878:Snapc4 UTSW 2 26376153 critical splice donor site probably null
R3722:Snapc4 UTSW 2 26365428 missense probably benign
R3886:Snapc4 UTSW 2 26365498 nonsense probably null
R3887:Snapc4 UTSW 2 26365498 nonsense probably null
R3888:Snapc4 UTSW 2 26365498 nonsense probably null
R3889:Snapc4 UTSW 2 26365498 nonsense probably null
R4638:Snapc4 UTSW 2 26365302 missense probably damaging 1.00
R4663:Snapc4 UTSW 2 26374181 missense possibly damaging 0.77
R4879:Snapc4 UTSW 2 26365992 missense possibly damaging 0.93
R4922:Snapc4 UTSW 2 26369233 missense probably benign
R5385:Snapc4 UTSW 2 26374503 missense probably benign 0.44
R5525:Snapc4 UTSW 2 26369526 small deletion probably benign
R5762:Snapc4 UTSW 2 26378606 missense probably damaging 1.00
R5839:Snapc4 UTSW 2 26365534 missense probably benign 0.01
R6300:Snapc4 UTSW 2 26378551 missense probably benign 0.14
R6422:Snapc4 UTSW 2 26368303 missense probably benign 0.00
R6843:Snapc4 UTSW 2 26373599 missense probably benign 0.03
R7341:Snapc4 UTSW 2 26369261 missense probably benign 0.01
R7727:Snapc4 UTSW 2 26373434 missense probably damaging 1.00
X0010:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0011:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0014:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0017:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0021:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0023:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0028:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0033:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0064:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0067:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGATAAGGACACGAGAG -3'
(R):5'- AGGGCCTGTAGTGACTTTCC -3'

Sequencing Primer
(F):5'- AGGGCCAGAACCTTTGCACTC -3'
(R):5'- GTATGTGCCAGACCTTCCTCAG -3'
Posted On2019-05-13