Incidental Mutation 'R6876:Abcf1'
ID536437
Institutional Source Beutler Lab
Gene Symbol Abcf1
Ensembl Gene ENSMUSG00000038762
Gene NameATP-binding cassette, sub-family F (GCN20), member 1
SynonymsGCN20, D17Wsu166e, Abc50
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6876 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35956819-35969761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35959244 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 641 (D641N)
Ref Sequence ENSEMBL: ENSMUSP00000036881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043757] [ENSMUST00000174128]
Predicted Effect probably benign
Transcript: ENSMUST00000043757
AA Change: D641N

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036881
Gene: ENSMUSG00000038762
AA Change: D641N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
coiled coil region 46 79 N/A INTRINSIC
low complexity region 173 208 N/A INTRINSIC
low complexity region 218 234 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
AAA 320 524 9e-10 SMART
low complexity region 529 554 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
AAA 642 807 1.11e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174128
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the GCN20 subfamily. Unlike other members of the superfamily, this protein lacks the transmembrane domains which are characteristic of most ABC transporters. This protein may be regulated by tumor necrosis factor-alpha and play a role in enhancement of protein synthesis and the inflammation process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,385,096 D20G probably damaging Het
Aasdh T C 5: 76,896,441 T201A probably damaging Het
Abca12 T A 1: 71,263,508 D2184V probably damaging Het
Adgrv1 C A 13: 81,155,154 probably null Het
Aftph T C 11: 20,709,744 E693G probably damaging Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
Arv1 A G 8: 124,730,912 K185R probably damaging Het
Ces4a T A 8: 105,144,992 V258D possibly damaging Het
Col6a5 T C 9: 105,937,307 D502G unknown Het
Diaph1 A T 18: 37,896,373 H335Q unknown Het
Dtna G A 18: 23,611,110 V404I probably benign Het
Ephb1 T C 9: 101,984,120 D615G probably damaging Het
Gimap3 A T 6: 48,765,921 I25N probably damaging Het
Hao1 A G 2: 134,501,149 V274A probably benign Het
Hirip3 T C 7: 126,864,149 S426P probably damaging Het
Igkv4-69 T C 6: 69,283,834 D103G probably damaging Het
Kdm8 T C 7: 125,452,658 V141A probably benign Het
Mink1 G T 11: 70,607,435 A553S probably benign Het
Mpl T A 4: 118,457,120 Y60F probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo5a C A 9: 75,160,490 R609S probably benign Het
Myo5b A T 18: 74,707,955 H969L probably benign Het
Olfr1388 T C 11: 49,444,241 L130P probably damaging Het
Olfr354 T A 2: 36,907,822 I292N probably damaging Het
Olfr92 G C 17: 37,111,206 Q259E probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Prodh2 T A 7: 30,506,500 W207R probably damaging Het
Rfx6 A G 10: 51,719,991 K457E probably damaging Het
Sim1 A G 10: 50,983,695 E551G possibly damaging Het
Soat2 T C 15: 102,160,614 F358S probably damaging Het
Tes3-ps A G 13: 49,493,719 K24E probably benign Het
Txndc16 A G 14: 45,163,040 F335L possibly damaging Het
Unc45b T C 11: 82,922,912 Y382H probably benign Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vmn2r93 T A 17: 18,305,188 H369Q probably benign Het
Yy1 A G 12: 108,806,592 I265V probably benign Het
Zfp54 A T 17: 21,433,977 K244N probably damaging Het
Other mutations in Abcf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Abcf1 APN 17 35964010 missense probably damaging 1.00
IGL02008:Abcf1 APN 17 35962062 missense probably benign
IGL02209:Abcf1 APN 17 35964009 missense probably damaging 0.99
IGL02218:Abcf1 APN 17 35958338 missense probably benign 0.00
IGL02455:Abcf1 APN 17 35960129 missense probably damaging 1.00
IGL03238:Abcf1 APN 17 35963323 missense probably damaging 0.99
bamboo UTSW 17 35958062 splice site probably benign
IGL02837:Abcf1 UTSW 17 35957581 missense probably benign
R0007:Abcf1 UTSW 17 35959670 missense probably damaging 0.99
R0078:Abcf1 UTSW 17 35958062 splice site probably benign
R0617:Abcf1 UTSW 17 35961187 missense probably benign 0.00
R0655:Abcf1 UTSW 17 35957845 missense probably benign 0.20
R1421:Abcf1 UTSW 17 35960909 missense probably damaging 1.00
R1879:Abcf1 UTSW 17 35961812 missense probably benign 0.13
R3433:Abcf1 UTSW 17 35958217 missense probably benign 0.36
R3915:Abcf1 UTSW 17 35959510 missense possibly damaging 0.46
R4056:Abcf1 UTSW 17 35959915 missense possibly damaging 0.90
R4057:Abcf1 UTSW 17 35959915 missense possibly damaging 0.90
R4114:Abcf1 UTSW 17 35959254 missense probably benign 0.25
R4709:Abcf1 UTSW 17 35960177 missense probably damaging 1.00
R4722:Abcf1 UTSW 17 35958041 intron probably benign
R4932:Abcf1 UTSW 17 35959450 missense possibly damaging 0.62
R5129:Abcf1 UTSW 17 35960795 unclassified probably benign
R5255:Abcf1 UTSW 17 35959737 splice site probably null
R5517:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5518:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5660:Abcf1 UTSW 17 35963647 missense possibly damaging 0.87
R5836:Abcf1 UTSW 17 35962026 missense possibly damaging 0.77
R6193:Abcf1 UTSW 17 35963572 missense possibly damaging 0.77
R6247:Abcf1 UTSW 17 35961064 missense probably damaging 1.00
R6257:Abcf1 UTSW 17 35961182 missense probably benign 0.10
R7095:Abcf1 UTSW 17 35957511 missense possibly damaging 0.81
R7134:Abcf1 UTSW 17 35959252 missense possibly damaging 0.90
R7475:Abcf1 UTSW 17 35963567 critical splice donor site probably null
R7843:Abcf1 UTSW 17 35959243 missense possibly damaging 0.89
R7867:Abcf1 UTSW 17 35961998 missense probably damaging 0.99
R8228:Abcf1 UTSW 17 35961041 critical splice donor site probably null
RF037:Abcf1 UTSW 17 35963188 unclassified probably benign
RF038:Abcf1 UTSW 17 35963201 unclassified probably benign
RF041:Abcf1 UTSW 17 35963201 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTTAGGACTCACCGGTGTC -3'
(R):5'- AAGCGTCCCAAGGAGTACAC -3'

Sequencing Primer
(F):5'- TGTCAGCTTGCCAGTCAG -3'
(R):5'- AAGGAGTACACCGTGCGCTTC -3'
Posted On2018-10-18