Incidental Mutation 'R6909:Gjc2'
ID538936
Institutional Source Beutler Lab
Gene Symbol Gjc2
Ensembl Gene ENSMUSG00000043448
Gene Namegap junction protein, gamma 2
SynonymsB230382L12Rik, connexin 47, Gja12, Cx47
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location59175568-59183213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59177092 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 188 (V188E)
Ref Sequence ENSEMBL: ENSMUSP00000104421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108790] [ENSMUST00000108793]
Predicted Effect unknown
Transcript: ENSMUST00000108790
AA Change: V188E
SMART Domains Protein: ENSMUSP00000104418
Gene: ENSMUSG00000043448
AA Change: V188E

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000108793
AA Change: V188E
SMART Domains Protein: ENSMUSP00000104421
Gene: ENSMUSG00000043448
AA Change: V188E

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gap junction protein. Gap junction proteins are members of a large family of homologous connexins and comprise 4 transmembrane, 2 extracellular, and 3 cytoplasmic domains. This gene plays a key role in central myelination and is involved in peripheral myelination in humans. Defects in this gene are the cause of autosomal recessive Pelizaeus-Merzbacher-like disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele are viable and behaviorally normal with no CNS demyelination detected in the spinal cord. In contrast, mice homozygous for a different null allele display a conspicuous vacuolation of CNS nerve fibers, especially in the myelinated region of the optic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Gjc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Gjc2 APN 11 59177518 missense probably damaging 1.00
IGL02191:Gjc2 APN 11 59177560 missense probably damaging 0.99
FR4342:Gjc2 UTSW 11 59182743 unclassified probably benign
R0086:Gjc2 UTSW 11 59176846 missense probably benign 0.39
R0201:Gjc2 UTSW 11 59177590 missense possibly damaging 0.79
R1478:Gjc2 UTSW 11 59177608 missense possibly damaging 0.66
R5211:Gjc2 UTSW 11 59177458 missense possibly damaging 0.77
R5395:Gjc2 UTSW 11 59177489 missense possibly damaging 0.95
R5560:Gjc2 UTSW 11 59177359 missense possibly damaging 0.66
R5906:Gjc2 UTSW 11 59176841 missense probably benign 0.39
R7055:Gjc2 UTSW 11 59177030 missense unknown
R7241:Gjc2 UTSW 11 59177134 missense unknown
Z1177:Gjc2 UTSW 11 59177617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCAGCAAGAAGACCGTC -3'
(R):5'- GTCATGTACCTGGGCTATGCAG -3'

Sequencing Primer
(F):5'- CACTACGTGGGGGCAAG -3'
(R):5'- ATGCAGTCCACCGCTTG -3'
Posted On2018-11-06