Incidental Mutation 'R6930:Rbm33'
ID539930
Institutional Source Beutler Lab
Gene Symbol Rbm33
Ensembl Gene ENSMUSG00000048271
Gene NameRNA binding motif protein 33
Synonyms6430512A10Rik, 3200001K10Rik, Prr8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6930 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location28317121-28419239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28352506 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 199 (I199T)
Ref Sequence ENSEMBL: ENSMUSP00000110534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030920] [ENSMUST00000059644] [ENSMUST00000090355] [ENSMUST00000114884]
Predicted Effect probably benign
Transcript: ENSMUST00000030920
AA Change: I239T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030920
Gene: ENSMUSG00000048271
AA Change: I239T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059644
AA Change: I239T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062449
Gene: ENSMUSG00000048271
AA Change: I239T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
low complexity region 362 407 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
low complexity region 625 707 N/A INTRINSIC
low complexity region 817 837 N/A INTRINSIC
coiled coil region 846 891 N/A INTRINSIC
RRM 1160 1227 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090355
AA Change: I199T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091512
Gene: ENSMUSG00000048271
AA Change: I199T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114884
AA Change: I199T

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110534
Gene: ENSMUSG00000048271
AA Change: I199T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 267 287 N/A INTRINSIC
low complexity region 322 367 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
low complexity region 585 667 N/A INTRINSIC
low complexity region 777 797 N/A INTRINSIC
coiled coil region 806 851 N/A INTRINSIC
RRM 1120 1187 4.7e-6 SMART
Meta Mutation Damage Score 0.0862 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,516,563 D156E probably benign Het
2010300C02Rik A T 1: 37,624,945 I624N possibly damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Akr1e1 T C 13: 4,602,715 D41G probably damaging Het
Alcam T C 16: 52,305,655 I100V probably benign Het
Atr T C 9: 95,866,635 I411T probably benign Het
Bbs4 T C 9: 59,323,481 S453G probably benign Het
Brdt C T 5: 107,359,215 L494F probably benign Het
Ccser1 T C 6: 62,380,025 S816P probably benign Het
Cdk10 T C 8: 123,230,608 I157T probably damaging Het
Ceacam5 G A 7: 17,750,834 probably null Het
Chst15 T C 7: 132,269,030 I259V possibly damaging Het
Csmd1 A T 8: 16,092,395 M1498K probably damaging Het
D630045J12Rik T C 6: 38,158,216 D1343G probably damaging Het
Denr T C 5: 123,908,187 Y27H probably benign Het
Dopey1 T C 9: 86,531,772 probably null Het
Epg5 T C 18: 78,014,163 F1819S probably damaging Het
Flg2 T A 3: 93,201,335 Y223* probably null Het
Fry T C 5: 150,428,230 L1733P probably benign Het
Gabrb2 T C 11: 42,597,613 V302A probably damaging Het
Gimap9 G A 6: 48,677,667 D53N probably damaging Het
Gje1 G T 10: 14,718,142 L3I possibly damaging Het
Gm49383 G T 12: 69,192,812 A645E probably damaging Het
Gm8947 G A 1: 151,192,596 G60D probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gys2 A G 6: 142,459,380 probably null Het
Hace1 A G 10: 45,618,502 H136R probably damaging Het
Herc3 T G 6: 58,916,459 V902G probably damaging Het
Hspbp1 T C 7: 4,684,607 R2G probably benign Het
Iqch T A 9: 63,480,574 K811N possibly damaging Het
Kmt2a A G 9: 44,842,665 probably benign Het
Lonrf2 A T 1: 38,804,336 V372D probably benign Het
Lpin2 T C 17: 71,244,791 Y729H probably damaging Het
Lrrc32 A G 7: 98,499,264 N417S possibly damaging Het
Malrd1 T A 2: 15,797,667 C1064S unknown Het
Mast3 G A 8: 70,799,471 R20* probably null Het
Mypn A C 10: 63,116,939 I174S probably damaging Het
Nrg1 G A 8: 31,818,506 T505M probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr18 A G 9: 20,314,099 Y266H probably damaging Het
Olfr220 A G 1: 174,449,111 I163V probably damaging Het
Olfr8 A G 10: 78,955,781 D192G possibly damaging Het
Phf3 T C 1: 30,811,877 E1132G probably damaging Het
Pla2g4d A T 2: 120,270,633 M521K probably damaging Het
Plekhg1 A G 10: 3,963,770 H1164R possibly damaging Het
Plxnb2 A G 15: 89,160,389 V1218A probably benign Het
Pold1 A G 7: 44,542,206 S119P probably benign Het
Pole T A 5: 110,293,290 D203E probably benign Het
Rapgefl1 T A 11: 98,847,121 L387Q probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 C A 11: 50,398,380 R545L probably benign Het
Ryr3 T A 2: 112,860,354 D1117V probably damaging Het
Sap130 T C 18: 31,682,088 V621A possibly damaging Het
Sparcl1 T A 5: 104,087,074 Y525F probably damaging Het
Spon2 A G 5: 33,216,427 V180A probably benign Het
Trav10n G A 14: 53,122,490 V75M probably benign Het
Ttc34 T C 4: 154,839,086 L84P probably damaging Het
Vmn1r23 C T 6: 57,926,145 R216K probably benign Het
Vmn2r61 A G 7: 42,299,940 T595A probably benign Het
Vmn2r66 T A 7: 85,012,008 I5F possibly damaging Het
Zfp879 C T 11: 50,833,012 G406R probably damaging Het
Zic2 A T 14: 122,476,457 D261V probably damaging Het
Other mutations in Rbm33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Rbm33 APN 5 28410709 missense probably damaging 0.98
IGL01470:Rbm33 APN 5 28387848 missense probably damaging 1.00
IGL01565:Rbm33 APN 5 28391079 unclassified probably benign
IGL02119:Rbm33 APN 5 28339017 missense probably damaging 1.00
IGL02740:Rbm33 APN 5 28331123 missense probably damaging 1.00
IGL02869:Rbm33 APN 5 28410755 missense probably damaging 0.99
IGL03355:Rbm33 APN 5 28391061 unclassified probably benign
IGL03381:Rbm33 APN 5 28394392 missense unknown
FR4449:Rbm33 UTSW 5 28394168 small deletion probably benign
FR4548:Rbm33 UTSW 5 28394201 small deletion probably benign
R0091:Rbm33 UTSW 5 28352606 missense possibly damaging 0.94
R0725:Rbm33 UTSW 5 28394483 missense unknown
R1522:Rbm33 UTSW 5 28337004 missense probably damaging 1.00
R1918:Rbm33 UTSW 5 28387917 missense probably damaging 1.00
R2186:Rbm33 UTSW 5 28394230 missense unknown
R2448:Rbm33 UTSW 5 28342417 missense probably benign 0.01
R4151:Rbm33 UTSW 5 28387940 missense probably damaging 1.00
R4685:Rbm33 UTSW 5 28408282 unclassified probably benign
R4787:Rbm33 UTSW 5 28342437 intron probably null
R4954:Rbm33 UTSW 5 28339276 missense probably damaging 1.00
R5013:Rbm33 UTSW 5 28342411 missense probably benign 0.05
R5141:Rbm33 UTSW 5 28352689 missense probably damaging 1.00
R5248:Rbm33 UTSW 5 28337052 critical splice donor site probably null
R5259:Rbm33 UTSW 5 28352774 intron probably null
R5695:Rbm33 UTSW 5 28339012 missense probably damaging 1.00
R5790:Rbm33 UTSW 5 28339298 missense probably damaging 1.00
R6591:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6668:Rbm33 UTSW 5 28342500 missense probably benign 0.01
R6691:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6931:Rbm33 UTSW 5 28410745 missense probably damaging 1.00
R7034:Rbm33 UTSW 5 28394498 missense unknown
R7056:Rbm33 UTSW 5 28394003 unclassified probably benign
R7224:Rbm33 UTSW 5 28394324 missense
R7579:Rbm33 UTSW 5 28368266 missense probably damaging 1.00
RF011:Rbm33 UTSW 5 28394181 small deletion probably benign
RF026:Rbm33 UTSW 5 28394181 small deletion probably benign
RF047:Rbm33 UTSW 5 28394162 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AACTGTAGGCAGGAGTTTGC -3'
(R):5'- TGAGCATAGCACAACTGGGC -3'

Sequencing Primer
(F):5'- CAGGAGTTTGCAGGTTTTTCCCTAC -3'
(R):5'- GGTGGGGGAATTTAATTAATTTACCC -3'
Posted On2018-11-06