Incidental Mutation 'R5259:Rbm33'
ID401292
Institutional Source Beutler Lab
Gene Symbol Rbm33
Ensembl Gene ENSMUSG00000048271
Gene NameRNA binding motif protein 33
Synonyms6430512A10Rik, 3200001K10Rik, Prr8
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location28317121-28419239 bp(+) (GRCm38)
Type of Mutationintron (131 bp from exon)
DNA Base Change (assembly) T to A at 28352774 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030920] [ENSMUST00000059644] [ENSMUST00000090355] [ENSMUST00000114884]
Predicted Effect probably benign
Transcript: ENSMUST00000030920
SMART Domains Protein: ENSMUSP00000030920
Gene: ENSMUSG00000048271

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000059644
SMART Domains Protein: ENSMUSP00000062449
Gene: ENSMUSG00000048271

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
low complexity region 362 407 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
low complexity region 625 707 N/A INTRINSIC
low complexity region 817 837 N/A INTRINSIC
coiled coil region 846 891 N/A INTRINSIC
RRM 1160 1227 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090355
SMART Domains Protein: ENSMUSP00000091512
Gene: ENSMUSG00000048271

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114884
SMART Domains Protein: ENSMUSP00000110534
Gene: ENSMUSG00000048271

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 267 287 N/A INTRINSIC
low complexity region 322 367 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
low complexity region 585 667 N/A INTRINSIC
low complexity region 777 797 N/A INTRINSIC
coiled coil region 806 851 N/A INTRINSIC
RRM 1120 1187 4.7e-6 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Rbm33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Rbm33 APN 5 28410709 missense probably damaging 0.98
IGL01470:Rbm33 APN 5 28387848 missense probably damaging 1.00
IGL01565:Rbm33 APN 5 28391079 unclassified probably benign
IGL02119:Rbm33 APN 5 28339017 missense probably damaging 1.00
IGL02740:Rbm33 APN 5 28331123 missense probably damaging 1.00
IGL02869:Rbm33 APN 5 28410755 missense probably damaging 0.99
IGL03355:Rbm33 APN 5 28391061 unclassified probably benign
IGL03381:Rbm33 APN 5 28394392 missense unknown
FR4449:Rbm33 UTSW 5 28394168 small deletion probably benign
FR4548:Rbm33 UTSW 5 28394201 small deletion probably benign
R0091:Rbm33 UTSW 5 28352606 missense possibly damaging 0.94
R0725:Rbm33 UTSW 5 28394483 missense unknown
R1522:Rbm33 UTSW 5 28337004 missense probably damaging 1.00
R1918:Rbm33 UTSW 5 28387917 missense probably damaging 1.00
R2186:Rbm33 UTSW 5 28394230 missense unknown
R2448:Rbm33 UTSW 5 28342417 missense probably benign 0.01
R4151:Rbm33 UTSW 5 28387940 missense probably damaging 1.00
R4685:Rbm33 UTSW 5 28408282 unclassified probably benign
R4787:Rbm33 UTSW 5 28342437 intron probably null
R4954:Rbm33 UTSW 5 28339276 missense probably damaging 1.00
R5013:Rbm33 UTSW 5 28342411 missense probably benign 0.05
R5141:Rbm33 UTSW 5 28352689 missense probably damaging 1.00
R5248:Rbm33 UTSW 5 28337052 critical splice donor site probably null
R5695:Rbm33 UTSW 5 28339012 missense probably damaging 1.00
R5790:Rbm33 UTSW 5 28339298 missense probably damaging 1.00
R6591:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6668:Rbm33 UTSW 5 28342500 missense probably benign 0.01
R6691:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6930:Rbm33 UTSW 5 28352506 missense probably benign 0.09
R6931:Rbm33 UTSW 5 28410745 missense probably damaging 1.00
R7034:Rbm33 UTSW 5 28394498 missense unknown
R7056:Rbm33 UTSW 5 28394003 unclassified probably benign
R7224:Rbm33 UTSW 5 28394324 missense
R7579:Rbm33 UTSW 5 28368266 missense probably damaging 1.00
R7922:Rbm33 UTSW 5 28368399 intron probably null
R8009:Rbm33 UTSW 5 28394608 missense not run
R8051:Rbm33 UTSW 5 28352625 missense not run
RF011:Rbm33 UTSW 5 28394181 small deletion probably benign
RF026:Rbm33 UTSW 5 28394181 small deletion probably benign
RF047:Rbm33 UTSW 5 28394162 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TAGGCTTTCAGATGTAACTAGAGAG -3'
(R):5'- TGACCCTGCTACCACCTTAG -3'

Sequencing Primer
(F):5'- TGTAACTAGAGAGAGAAGGAACATTC -3'
(R):5'- TGCTACCACCTTAGTACAGTCAAG -3'
Posted On2016-07-06