Mutagenetix > Incidental Mutation

Incidental Mutation 'R6930:Malrd1'

539923

Institutional Source

Beutler Lab

Gene Symbol

Malrd1

Ensembl Gene

ENSMUSG00000075520

Gene Name

MAM and LDL receptor class A domain containing 1

Synonyms

Diet1, Gm13364, Gm13318

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R6930 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15526479-16255555 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 15797667 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1064 (C1064S)

Ref Sequence

ENSEMBL: ENSMUSP00000116869 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146205]

AlphaFold

A2AJX4

Predicted Effect

unknown
Transcript: ENSMUST00000146205
AA Change: C1064S

SMART Domains

Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: C1064S

Domain	Start	End	E-Value	Type
Pfam:MAM	8	171	1.6e-36	PFAM
LDLa	181	219	6.89e-8	SMART
LDLa	225	262	4.37e-10	SMART
LDLa	264	303	9.55e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

100% (63/63)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,516,563	D156E	probably benign	Het
2010300C02Rik	A	T	1: 37,624,945	I624N	possibly damaging	Het
Adam17	A	T	12: 21,353,948	V99E	probably damaging	Het
Akr1e1	T	C	13: 4,602,715	D41G	probably damaging	Het
Alcam	T	C	16: 52,305,655	I100V	probably benign	Het
Atr	T	C	9: 95,866,635	I411T	probably benign	Het
Bbs4	T	C	9: 59,323,481	S453G	probably benign	Het
Brdt	C	T	5: 107,359,215	L494F	probably benign	Het
Ccser1	T	C	6: 62,380,025	S816P	probably benign	Het
Cdk10	T	C	8: 123,230,608	I157T	probably damaging	Het
Ceacam5	G	A	7: 17,750,834		probably null	Het
Chst15	T	C	7: 132,269,030	I259V	possibly damaging	Het
Csmd1	A	T	8: 16,092,395	M1498K	probably damaging	Het
D630045J12Rik	T	C	6: 38,158,216	D1343G	probably damaging	Het
Denr	T	C	5: 123,908,187	Y27H	probably benign	Het
Dopey1	T	C	9: 86,531,772		probably null	Het
Epg5	T	C	18: 78,014,163	F1819S	probably damaging	Het
Flg2	T	A	3: 93,201,335	Y223*	probably null	Het
Fry	T	C	5: 150,428,230	L1733P	probably benign	Het
Gabrb2	T	C	11: 42,597,613	V302A	probably damaging	Het
Gimap9	G	A	6: 48,677,667	D53N	probably damaging	Het
Gje1	G	T	10: 14,718,142	L3I	possibly damaging	Het
Gm49383	G	T	12: 69,192,812	A645E	probably damaging	Het
Gm8947	G	A	1: 151,192,596	G60D	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gys2	A	G	6: 142,459,380		probably null	Het
Hace1	A	G	10: 45,618,502	H136R	probably damaging	Het
Herc3	T	G	6: 58,916,459	V902G	probably damaging	Het
Hspbp1	T	C	7: 4,684,607	R2G	probably benign	Het
Iqch	T	A	9: 63,480,574	K811N	possibly damaging	Het
Kmt2a	A	G	9: 44,842,665		probably benign	Het
Lonrf2	A	T	1: 38,804,336	V372D	probably benign	Het
Lpin2	T	C	17: 71,244,791	Y729H	probably damaging	Het
Lrrc32	A	G	7: 98,499,264	N417S	possibly damaging	Het
Mast3	G	A	8: 70,799,471	R20*	probably null	Het
Mypn	A	C	10: 63,116,939	I174S	probably damaging	Het
Nrg1	G	A	8: 31,818,506	T505M	probably damaging	Het
Olfr1340	A	G	4: 118,727,141	K298R	probably damaging	Het
Olfr18	A	G	9: 20,314,099	Y266H	probably damaging	Het
Olfr220	A	G	1: 174,449,111	I163V	probably damaging	Het
Olfr8	A	G	10: 78,955,781	D192G	possibly damaging	Het
Phf3	T	C	1: 30,811,877	E1132G	probably damaging	Het
Pla2g4d	A	T	2: 120,270,633	M521K	probably damaging	Het
Plekhg1	A	G	10: 3,963,770	H1164R	possibly damaging	Het
Plxnb2	A	G	15: 89,160,389	V1218A	probably benign	Het
Pold1	A	G	7: 44,542,206	S119P	probably benign	Het
Pole	T	A	5: 110,293,290	D203E	probably benign	Het
Rapgefl1	T	A	11: 98,847,121	L387Q	probably damaging	Het
Rbm33	T	C	5: 28,352,506	I199T	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	C	A	11: 50,398,380	R545L	probably benign	Het
Ryr3	T	A	2: 112,860,354	D1117V	probably damaging	Het
Sap130	T	C	18: 31,682,088	V621A	possibly damaging	Het
Sparcl1	T	A	5: 104,087,074	Y525F	probably damaging	Het
Spon2	A	G	5: 33,216,427	V180A	probably benign	Het
Trav10n	G	A	14: 53,122,490	V75M	probably benign	Het
Ttc34	T	C	4: 154,839,086	L84P	probably damaging	Het
Vmn1r23	C	T	6: 57,926,145	R216K	probably benign	Het
Vmn2r61	A	G	7: 42,299,940	T595A	probably benign	Het
Vmn2r66	T	A	7: 85,012,008	I5F	possibly damaging	Het
Zfp879	C	T	11: 50,833,012	G406R	probably damaging	Het
Zic2	A	T	14: 122,476,457	D261V	probably damaging	Het

Other mutations in Malrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Malrd1	APN	2	16142186	splice site	probably benign
IGL01295:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01296:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01399:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01400:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01401:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01402:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01405:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01406:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL02105:Malrd1	APN	2	16127863	missense	unknown
IGL02581:Malrd1	APN	2	16142312	nonsense	probably null
IGL03015:Malrd1	APN	2	16042271	missense	unknown
IGL03038:Malrd1	APN	2	16127967	missense	unknown
R1353:Malrd1	UTSW	2	16127968	missense	unknown
R1385:Malrd1	UTSW	2	16042228	missense	unknown
R2242:Malrd1	UTSW	2	16101944	missense	unknown
R2888:Malrd1	UTSW	2	16074757	missense	unknown
R4398:Malrd1	UTSW	2	16150783	missense	unknown
R4982:Malrd1	UTSW	2	16042129	missense	probably benign	0.29
R5148:Malrd1	UTSW	2	16142226	missense	unknown
R5195:Malrd1	UTSW	2	16150810	missense	unknown
R5828:Malrd1	UTSW	2	15526653	missense	probably benign	0.00
R5892:Malrd1	UTSW	2	15614267	missense	probably benign	0.03
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6195:Malrd1	UTSW	2	15695326	missense	probably damaging	1.00
R6318:Malrd1	UTSW	2	16042267	missense	unknown
R6438:Malrd1	UTSW	2	15614206	missense
R6457:Malrd1	UTSW	2	15526597	start gained	probably benign
R6457:Malrd1	UTSW	2	15667929	missense	probably benign	0.41
R6499:Malrd1	UTSW	2	15931689	missense	probably benign	0.03
R6575:Malrd1	UTSW	2	15842628	missense	probably benign	0.00
R6792:Malrd1	UTSW	2	16150756	missense	unknown
R6796:Malrd1	UTSW	2	15869784	missense	unknown
R6959:Malrd1	UTSW	2	16218009	missense	probably damaging	0.97
R6993:Malrd1	UTSW	2	16150791	missense	unknown
R7102:Malrd1	UTSW	2	16142303	missense	unknown
R7112:Malrd1	UTSW	2	15925176	missense	unknown
R7248:Malrd1	UTSW	2	16101911	missense	unknown
R7249:Malrd1	UTSW	2	15623340	missense	probably damaging	0.97
R7334:Malrd1	UTSW	2	16006718	missense	probably damaging	0.99
R7394:Malrd1	UTSW	2	15695199	missense	unknown
R7399:Malrd1	UTSW	2	15610090	missense
R7476:Malrd1	UTSW	2	16142304	missense	unknown
R7582:Malrd1	UTSW	2	15695270	missense	unknown
R7604:Malrd1	UTSW	2	15925192	missense	unknown
R7662:Malrd1	UTSW	2	15871454	missense	unknown
R7681:Malrd1	UTSW	2	16218102	missense	unknown
R7740:Malrd1	UTSW	2	15614215	missense	not run
R7747:Malrd1	UTSW	2	16074835	missense	unknown
R7754:Malrd1	UTSW	2	15797799	splice site	probably null
R7950:Malrd1	UTSW	2	16128068	missense	unknown
R8194:Malrd1	UTSW	2	15925120	missense	unknown
R8260:Malrd1	UTSW	2	15614206	missense
R8314:Malrd1	UTSW	2	15752832	missense	unknown
R8342:Malrd1	UTSW	2	15633224	missense	unknown
R8386:Malrd1	UTSW	2	15696844	missense	unknown
R8492:Malrd1	UTSW	2	15610123	missense
R8728:Malrd1	UTSW	2	15696942	nonsense	probably null
R8756:Malrd1	UTSW	2	15752895	critical splice donor site	probably null
R8869:Malrd1	UTSW	2	15565557	critical splice donor site	probably null
R8888:Malrd1	UTSW	2	15845227	missense	unknown
R8895:Malrd1	UTSW	2	15845227	missense	unknown
R8902:Malrd1	UTSW	2	16255334	nonsense	probably null
R8954:Malrd1	UTSW	2	15551367	missense
R8960:Malrd1	UTSW	2	15565430	nonsense	probably null
R9005:Malrd1	UTSW	2	15845329	missense	unknown
R9135:Malrd1	UTSW	2	15797705	missense	unknown
R9267:Malrd1	UTSW	2	16255266	missense	unknown
R9330:Malrd1	UTSW	2	16255278	missense	unknown
R9359:Malrd1	UTSW	2	15614177	missense
R9383:Malrd1	UTSW	2	15695201	missense	unknown
R9389:Malrd1	UTSW	2	15703156	missense	unknown
R9403:Malrd1	UTSW	2	15614177	missense
R9454:Malrd1	UTSW	2	15752849	missense	unknown
R9454:Malrd1	UTSW	2	15797726	nonsense	probably null
R9520:Malrd1	UTSW	2	16074820	missense	unknown
R9544:Malrd1	UTSW	2	15635998	missense	unknown
R9609:Malrd1	UTSW	2	15695270	missense	unknown
R9667:Malrd1	UTSW	2	15565215	critical splice acceptor site	probably null
R9721:Malrd1	UTSW	2	15696827	missense	unknown
R9787:Malrd1	UTSW	2	15620590	missense	unknown
R9800:Malrd1	UTSW	2	15842594	missense	unknown
Z1176:Malrd1	UTSW	2	16217845	missense	unknown
Z1191:Malrd1	UTSW	2	16042226	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGAGAGGACACTGTTAATGTATGC -3'
(R):5'- TCAGGGAAATGTCTCCTAAGAAAGAC -3'

Sequencing Primer
(F):5'- TTTGTAGGATGCACCCACAG -3'
(R):5'- CTGATCCCATTACCGAGT -3'

Posted On

2018-11-06