Mutagenetix > Incidental Mutation

Incidental Mutation 'R6930:Pla2g4d'

539925

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4d

Ensembl Gene

ENSMUSG00000070719

Gene Name

phospholipase A2, group IVD

Synonyms

Pla2delta, 2610311B01Rik

MMRRC Submission

045046-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R6930 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120265595-120289197 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 120270633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 521 (M521K)

Ref Sequence

ENSEMBL: ENSMUSP00000092252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094665]

AlphaFold

Q50L43

Predicted Effect

probably damaging
Transcript: ENSMUST00000094665
AA Change: M521K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: M521K

Domain	Start	End	E-Value	Type
C2	32	132	1.12e-18	SMART
PLAc	263	766	3.36e-11	SMART

Meta Mutation Damage Score

0.6694

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,516,563	D156E	probably benign	Het
2010300C02Rik	A	T	1: 37,624,945	I624N	possibly damaging	Het
Adam17	A	T	12: 21,353,948	V99E	probably damaging	Het
Akr1e1	T	C	13: 4,602,715	D41G	probably damaging	Het
Alcam	T	C	16: 52,305,655	I100V	probably benign	Het
Atr	T	C	9: 95,866,635	I411T	probably benign	Het
Bbs4	T	C	9: 59,323,481	S453G	probably benign	Het
Brdt	C	T	5: 107,359,215	L494F	probably benign	Het
Ccser1	T	C	6: 62,380,025	S816P	probably benign	Het
Cdk10	T	C	8: 123,230,608	I157T	probably damaging	Het
Ceacam5	G	A	7: 17,750,834		probably null	Het
Chst15	T	C	7: 132,269,030	I259V	possibly damaging	Het
Csmd1	A	T	8: 16,092,395	M1498K	probably damaging	Het
D630045J12Rik	T	C	6: 38,158,216	D1343G	probably damaging	Het
Denr	T	C	5: 123,908,187	Y27H	probably benign	Het
Dopey1	T	C	9: 86,531,772		probably null	Het
Epg5	T	C	18: 78,014,163	F1819S	probably damaging	Het
Flg2	T	A	3: 93,201,335	Y223*	probably null	Het
Fry	T	C	5: 150,428,230	L1733P	probably benign	Het
Gabrb2	T	C	11: 42,597,613	V302A	probably damaging	Het
Gimap9	G	A	6: 48,677,667	D53N	probably damaging	Het
Gje1	G	T	10: 14,718,142	L3I	possibly damaging	Het
Gm49383	G	T	12: 69,192,812	A645E	probably damaging	Het
Gm8947	G	A	1: 151,192,596	G60D	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gys2	A	G	6: 142,459,380		probably null	Het
Hace1	A	G	10: 45,618,502	H136R	probably damaging	Het
Herc3	T	G	6: 58,916,459	V902G	probably damaging	Het
Hspbp1	T	C	7: 4,684,607	R2G	probably benign	Het
Iqch	T	A	9: 63,480,574	K811N	possibly damaging	Het
Kmt2a	A	G	9: 44,842,665		probably benign	Het
Lonrf2	A	T	1: 38,804,336	V372D	probably benign	Het
Lpin2	T	C	17: 71,244,791	Y729H	probably damaging	Het
Lrrc32	A	G	7: 98,499,264	N417S	possibly damaging	Het
Malrd1	T	A	2: 15,797,667	C1064S	unknown	Het
Mast3	G	A	8: 70,799,471	R20*	probably null	Het
Mypn	A	C	10: 63,116,939	I174S	probably damaging	Het
Nrg1	G	A	8: 31,818,506	T505M	probably damaging	Het
Olfr1340	A	G	4: 118,727,141	K298R	probably damaging	Het
Olfr18	A	G	9: 20,314,099	Y266H	probably damaging	Het
Olfr220	A	G	1: 174,449,111	I163V	probably damaging	Het
Olfr8	A	G	10: 78,955,781	D192G	possibly damaging	Het
Phf3	T	C	1: 30,811,877	E1132G	probably damaging	Het
Plekhg1	A	G	10: 3,963,770	H1164R	possibly damaging	Het
Plxnb2	A	G	15: 89,160,389	V1218A	probably benign	Het
Pold1	A	G	7: 44,542,206	S119P	probably benign	Het
Pole	T	A	5: 110,293,290	D203E	probably benign	Het
Rapgefl1	T	A	11: 98,847,121	L387Q	probably damaging	Het
Rbm33	T	C	5: 28,352,506	I199T	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	C	A	11: 50,398,380	R545L	probably benign	Het
Ryr3	T	A	2: 112,860,354	D1117V	probably damaging	Het
Sap130	T	C	18: 31,682,088	V621A	possibly damaging	Het
Sparcl1	T	A	5: 104,087,074	Y525F	probably damaging	Het
Spon2	A	G	5: 33,216,427	V180A	probably benign	Het
Trav10n	G	A	14: 53,122,490	V75M	probably benign	Het
Ttc34	T	C	4: 154,839,086	L84P	probably damaging	Het
Vmn1r23	C	T	6: 57,926,145	R216K	probably benign	Het
Vmn2r61	A	G	7: 42,299,940	T595A	probably benign	Het
Vmn2r66	T	A	7: 85,012,008	I5F	possibly damaging	Het
Zfp879	C	T	11: 50,833,012	G406R	probably damaging	Het
Zic2	A	T	14: 122,476,457	D261V	probably damaging	Het

Other mutations in Pla2g4d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Pla2g4d	APN	2	120281726	missense	probably damaging	1.00
IGL01405:Pla2g4d	APN	2	120266823	missense	probably benign	0.01
IGL01642:Pla2g4d	APN	2	120280636	missense	probably damaging	1.00
IGL01657:Pla2g4d	APN	2	120275287	missense	possibly damaging	0.91
BB001:Pla2g4d	UTSW	2	120289164	start gained	probably benign
R0962:Pla2g4d	UTSW	2	120280617	critical splice donor site	probably null
R1564:Pla2g4d	UTSW	2	120268903	missense	possibly damaging	0.76
R1576:Pla2g4d	UTSW	2	120284167	missense	probably damaging	1.00
R1667:Pla2g4d	UTSW	2	120270150	splice site	probably benign
R1680:Pla2g4d	UTSW	2	120277750	critical splice donor site	probably null
R1712:Pla2g4d	UTSW	2	120277490	missense	possibly damaging	0.51
R2253:Pla2g4d	UTSW	2	120271141	missense	probably damaging	0.99
R2919:Pla2g4d	UTSW	2	120281627	splice site	probably benign
R3122:Pla2g4d	UTSW	2	120278903	missense	probably benign	0.03
R4420:Pla2g4d	UTSW	2	120284163	missense	probably benign
R4737:Pla2g4d	UTSW	2	120266790	missense	probably benign	0.00
R4829:Pla2g4d	UTSW	2	120266743	missense	probably damaging	1.00
R5032:Pla2g4d	UTSW	2	120281695	nonsense	probably null
R5530:Pla2g4d	UTSW	2	120269555	missense	probably benign	0.06
R5677:Pla2g4d	UTSW	2	120278948	missense	possibly damaging	0.87
R6087:Pla2g4d	UTSW	2	120270006	missense	probably damaging	1.00
R6088:Pla2g4d	UTSW	2	120270006	missense	probably damaging	1.00
R6150:Pla2g4d	UTSW	2	120269564	missense	probably damaging	1.00
R7240:Pla2g4d	UTSW	2	120270349	missense	probably damaging	1.00
R7284:Pla2g4d	UTSW	2	120284136	missense	probably damaging	1.00
R7339:Pla2g4d	UTSW	2	120278978	missense	probably benign
R7552:Pla2g4d	UTSW	2	120284139	missense	possibly damaging	0.56
R7607:Pla2g4d	UTSW	2	120288976	missense	probably benign
R7692:Pla2g4d	UTSW	2	120279295	missense	possibly damaging	0.84
R7860:Pla2g4d	UTSW	2	120266730	missense	probably benign	0.13
R7924:Pla2g4d	UTSW	2	120289164	start gained	probably benign
R7972:Pla2g4d	UTSW	2	120278932	missense	probably benign	0.04
R8373:Pla2g4d	UTSW	2	120277499	missense	probably null	1.00
R8737:Pla2g4d	UTSW	2	120269985	missense	probably damaging	1.00
R8752:Pla2g4d	UTSW	2	120268767	critical splice donor site	probably null
R8987:Pla2g4d	UTSW	2	120269961	missense	probably damaging	1.00
R9221:Pla2g4d	UTSW	2	120269972	missense	possibly damaging	0.76
R9251:Pla2g4d	UTSW	2	120268897	missense	possibly damaging	0.87
R9740:Pla2g4d	UTSW	2	120277471	missense	probably damaging	1.00
X0026:Pla2g4d	UTSW	2	120277471	missense	probably damaging	0.99
X0028:Pla2g4d	UTSW	2	120281726	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCAGTAGAAAATGGGTGTGG -3'
(R):5'- AGGAGTCTGCTTCCCTCATACC -3'

Sequencing Primer
(F):5'- TGTGGGGAAAGAGCAATTTCATC -3'
(R):5'- AAGGGGCAGTTTCACAGGCTC -3'

Posted On

2018-11-06