Incidental Mutation 'R1818:Tecpr2'
ID204638
Institutional Source Beutler Lab
Gene Symbol Tecpr2
Ensembl Gene ENSMUSG00000021275
Gene Nametectonin beta-propeller repeat containing 2
Synonyms
MMRRC Submission 039846-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1818 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location110889264-110972394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110926454 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 310 (Y310C)
Ref Sequence ENSEMBL: ENSMUSP00000152826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]
Predicted Effect probably damaging
Transcript: ENSMUST00000165978
AA Change: Y310C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275
AA Change: Y310C

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169597
AA Change: Y310C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275
AA Change: Y310C

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221605
Predicted Effect probably damaging
Transcript: ENSMUST00000223210
AA Change: Y310C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223246
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,858 probably null Het
Adam6b T A 12: 113,491,256 N564K probably benign Het
Ahi1 A G 10: 20,988,562 Y731C probably damaging Het
Ankk1 A G 9: 49,420,425 Y190H probably benign Het
Ankmy1 T A 1: 92,886,831 D318V probably benign Het
Ankrd33b G A 15: 31,367,121 A91V probably damaging Het
Ap3b1 A G 13: 94,471,704 N561S possibly damaging Het
Apob A G 12: 8,006,834 N1739S probably damaging Het
Apob A G 12: 8,013,064 T236A possibly damaging Het
Birc6 G A 17: 74,649,849 A3593T probably damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccl20 A G 1: 83,117,808 Y30C probably damaging Het
Cd209a G A 8: 3,745,576 T106I probably damaging Het
Cebpz A G 17: 78,935,376 L283P probably damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Clec4e T A 6: 123,285,493 D155V possibly damaging Het
Col25a1 G A 3: 130,585,737 probably null Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Denr T A 5: 123,917,220 D49E probably benign Het
Dnaaf3 A T 7: 4,523,569 probably null Het
Dnaaf3 G T 7: 4,523,570 L503M probably benign Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Ehd4 C T 2: 120,102,404 W180* probably null Het
Ephb2 A G 4: 136,655,336 S984P probably benign Het
Eva1a T C 6: 82,071,144 M1T probably null Het
Fam90a1a C G 8: 21,963,771 P381A possibly damaging Het
Fam90a1a C A 8: 21,963,772 P381Q probably damaging Het
Flnc T C 6: 29,457,448 Y2382H probably damaging Het
Flrt1 A T 19: 7,095,346 L612Q probably damaging Het
Fubp1 T A 3: 152,222,169 N419K probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm11639 T A 11: 104,721,507 L652Q probably benign Het
Gm4847 T A 1: 166,638,219 H267L probably damaging Het
Golga4 T G 9: 118,572,987 V91G probably damaging Het
Hip1r T C 5: 123,995,955 probably null Het
Ice2 A G 9: 69,432,101 S967G probably benign Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Impdh2 T G 9: 108,563,212 probably null Het
Inmt C A 6: 55,173,419 V78F possibly damaging Het
Inpp5e T C 2: 26,397,874 S637G probably benign Het
Kansl1 T C 11: 104,342,457 H748R possibly damaging Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Kifc2 T C 15: 76,666,081 V480A probably damaging Het
Lrrc74a T C 12: 86,737,710 Y71H probably damaging Het
Ly75 T G 2: 60,311,777 T1330P probably damaging Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mgat1 T C 11: 49,261,284 I198T possibly damaging Het
Morc3 A G 16: 93,855,510 Y367C probably damaging Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Mtfr1 A G 3: 19,215,673 T162A probably damaging Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nup153 A T 13: 46,681,637 N1397K possibly damaging Het
Olfr196 T C 16: 59,167,880 K88E probably benign Het
Olfr883 T C 9: 38,026,507 S234P probably damaging Het
Olfr935 T C 9: 38,994,606 I276M possibly damaging Het
Olfr986 T C 9: 40,187,262 V49A probably benign Het
Pabpc2 G T 18: 39,774,110 V143L probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Patj G A 4: 98,623,648 V144M possibly damaging Het
Pde1c T A 6: 56,126,892 K651* probably null Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdha2 T A 3: 141,211,199 K183* probably null Het
Pkd1l3 T A 8: 109,648,406 C1504S probably benign Het
Plbd2 A T 5: 120,487,509 probably null Het
Poteg G A 8: 27,450,167 W121* probably null Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Ptprf A G 4: 118,209,871 Y1883H probably damaging Het
Puf60 T C 15: 76,071,474 T322A possibly damaging Het
Rev3l A G 10: 39,828,424 I281M probably benign Het
Rufy1 T C 11: 50,414,572 I305V probably benign Het
Shisa9 A C 16: 12,267,562 Q329P probably damaging Het
Siglech G A 7: 55,768,584 R100Q probably damaging Het
Slc13a5 T A 11: 72,253,343 Y303F probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Top1 T A 2: 160,715,723 L575Q probably damaging Het
Usp16 C T 16: 87,479,132 R452* probably null Het
Utrn A G 10: 12,709,964 probably null Het
Vps13b G A 15: 35,877,577 G2899E probably benign Het
Wdr78 A G 4: 103,072,657 V56A possibly damaging Het
Wipi2 T A 5: 142,658,208 L115Q probably damaging Het
Zbtb7c A C 18: 76,137,525 E228A probably damaging Het
Zfp26 T C 9: 20,442,191 T101A probably benign Het
Zfp593 A T 4: 134,245,083 probably null Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp948 G A 17: 21,584,807 V20M probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Tecpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Tecpr2 APN 12 110967779 missense possibly damaging 0.67
IGL01759:Tecpr2 APN 12 110931392 utr 3 prime probably benign
IGL02114:Tecpr2 APN 12 110968887 missense probably damaging 1.00
IGL02813:Tecpr2 APN 12 110933192 missense probably damaging 1.00
IGL02943:Tecpr2 APN 12 110967749 missense probably benign
IGL03085:Tecpr2 APN 12 110954826 splice site probably benign
IGL03290:Tecpr2 APN 12 110967833 missense possibly damaging 0.65
R0362:Tecpr2 UTSW 12 110968940 missense probably damaging 0.96
R0486:Tecpr2 UTSW 12 110896369 missense probably benign 0.01
R0662:Tecpr2 UTSW 12 110896228 missense probably benign 0.02
R0787:Tecpr2 UTSW 12 110946343 missense probably benign 0.30
R1147:Tecpr2 UTSW 12 110941438 splice site probably benign
R1454:Tecpr2 UTSW 12 110968953 missense probably benign 0.00
R1513:Tecpr2 UTSW 12 110954800 missense possibly damaging 0.94
R1567:Tecpr2 UTSW 12 110941596 critical splice donor site probably null
R1569:Tecpr2 UTSW 12 110944887 critical splice donor site probably null
R1856:Tecpr2 UTSW 12 110933064 missense probably benign
R1897:Tecpr2 UTSW 12 110933247 missense probably benign
R1903:Tecpr2 UTSW 12 110947912 missense probably damaging 0.98
R1939:Tecpr2 UTSW 12 110933169 missense probably damaging 0.98
R1982:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R2073:Tecpr2 UTSW 12 110968429 missense possibly damaging 0.51
R2393:Tecpr2 UTSW 12 110926402 missense probably damaging 0.99
R2443:Tecpr2 UTSW 12 110896325 missense probably damaging 1.00
R2484:Tecpr2 UTSW 12 110933318 missense probably benign
R4564:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R4723:Tecpr2 UTSW 12 110932976 missense probably benign 0.01
R4835:Tecpr2 UTSW 12 110954730 missense probably benign 0.00
R4847:Tecpr2 UTSW 12 110939877 missense probably damaging 1.00
R4911:Tecpr2 UTSW 12 110931487 missense possibly damaging 0.74
R5179:Tecpr2 UTSW 12 110944693 missense possibly damaging 0.63
R5266:Tecpr2 UTSW 12 110915402 missense probably damaging 1.00
R5386:Tecpr2 UTSW 12 110915453 missense probably damaging 1.00
R5486:Tecpr2 UTSW 12 110933015 missense probably benign 0.03
R5490:Tecpr2 UTSW 12 110914684 missense probably damaging 1.00
R5627:Tecpr2 UTSW 12 110941482 missense probably damaging 0.97
R5836:Tecpr2 UTSW 12 110931511 missense possibly damaging 0.76
R6052:Tecpr2 UTSW 12 110918891 missense possibly damaging 0.89
R6084:Tecpr2 UTSW 12 110929109 missense probably damaging 0.98
R6306:Tecpr2 UTSW 12 110944751 missense probably damaging 1.00
R6563:Tecpr2 UTSW 12 110929087 missense probably benign 0.00
R6936:Tecpr2 UTSW 12 110944863 missense possibly damaging 0.83
R6977:Tecpr2 UTSW 12 110939766 missense probably benign 0.17
R7110:Tecpr2 UTSW 12 110918972 missense probably damaging 1.00
R7132:Tecpr2 UTSW 12 110915372 missense probably damaging 0.97
R7353:Tecpr2 UTSW 12 110967844 missense probably benign 0.06
R7362:Tecpr2 UTSW 12 110941476 missense possibly damaging 0.85
R7366:Tecpr2 UTSW 12 110915480 critical splice donor site probably null
R7404:Tecpr2 UTSW 12 110931604 missense probably benign 0.00
R7478:Tecpr2 UTSW 12 110968439 missense probably benign 0.36
R7774:Tecpr2 UTSW 12 110933172 missense probably benign 0.00
R7922:Tecpr2 UTSW 12 110932642 frame shift probably null
R7997:Tecpr2 UTSW 12 110933603 missense probably benign 0.02
R8037:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
R8038:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
R8393:Tecpr2 UTSW 12 110944757 missense probably damaging 0.99
R8411:Tecpr2 UTSW 12 110931720 missense possibly damaging 0.63
R8726:Tecpr2 UTSW 12 110938234 missense possibly damaging 0.82
Z1176:Tecpr2 UTSW 12 110896310 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCAAGCCACATATATCCTCAAGG -3'
(R):5'- GCACGTGTGAGTTTTGCATAC -3'

Sequencing Primer
(F):5'- CCTCAAGGATGTCTTTGCTGGC -3'
(R):5'- CGTGTGAGTTTTGCATACACACAC -3'
Posted On2014-06-23