Incidental Mutation 'R6052:Tecpr2'
ID484181
Institutional Source Beutler Lab
Gene Symbol Tecpr2
Ensembl Gene ENSMUSG00000021275
Gene Nametectonin beta-propeller repeat containing 2
Synonyms
MMRRC Submission 044220-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6052 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110889264-110972394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110918891 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 168 (V168A)
Ref Sequence ENSEMBL: ENSMUSP00000152826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165978
AA Change: V168A

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275
AA Change: V168A

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169597
AA Change: V168A

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275
AA Change: V168A

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221605
Predicted Effect possibly damaging
Transcript: ENSMUST00000223210
AA Change: V168A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223246
Meta Mutation Damage Score 0.1510 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,318,191 F473L probably benign Het
Ankrd17 T C 5: 90,253,832 I1449V probably benign Het
Aox4 T A 1: 58,254,318 L943* probably null Het
Arap1 G A 7: 101,404,033 V1257M probably damaging Het
B3gnt9 T C 8: 105,254,598 S53G probably benign Het
Baiap3 A T 17: 25,248,470 probably benign Het
Canx T C 11: 50,297,119 D554G possibly damaging Het
Cbfa2t2 T C 2: 154,510,581 V165A probably damaging Het
Ccdc17 C T 4: 116,599,948 probably null Het
Cdcp1 A G 9: 123,185,331 I126T probably benign Het
Cdk13 A T 13: 17,721,215 D1036E probably damaging Het
Cfap157 A G 2: 32,779,851 L240P probably damaging Het
Clec18a C A 8: 111,078,816 E218* probably null Het
Col3a1 T C 1: 45,345,013 probably benign Het
Dennd4a A G 9: 64,886,945 E682G probably damaging Het
Dnah14 T C 1: 181,666,487 V1736A possibly damaging Het
Dpep2 T A 8: 105,990,638 D162V possibly damaging Het
Drd3 C A 16: 43,821,283 P321T probably benign Het
Egfr A G 11: 16,911,554 H1111R probably benign Het
Entpd1 T C 19: 40,720,484 S58P probably damaging Het
Epha3 C A 16: 63,603,604 V541L possibly damaging Het
Eri3 T A 4: 117,564,628 D34E probably damaging Het
Eya1 T C 1: 14,283,150 D58G probably damaging Het
Fat3 T A 9: 15,922,679 S26C probably null Het
Fgl1 T C 8: 41,200,511 D115G probably damaging Het
Fitm2 T C 2: 163,470,116 Y59C probably damaging Het
Fras1 T A 5: 96,764,866 I3343N probably damaging Het
Gba2 C A 4: 43,568,330 C679F probably damaging Het
Glis2 G A 16: 4,613,739 probably benign Het
Gm13088 T A 4: 143,655,652 D158V probably damaging Het
Gm5150 T A 3: 15,990,753 I103F probably damaging Het
H2-Ke6 A G 17: 34,027,455 L118P probably damaging Het
Hhipl2 T C 1: 183,424,057 S313P possibly damaging Het
Hmgcs1 A G 13: 119,705,459 D474G probably benign Het
Homer3 C T 8: 70,291,426 Q267* probably null Het
Igkv8-28 C T 6: 70,143,689 G90D probably damaging Het
Kalrn T A 16: 34,360,885 I128F probably damaging Het
Krt4 A G 15: 101,922,759 probably null Het
Lamb2 T A 9: 108,487,612 C1188* probably null Het
Lsr A T 7: 30,958,617 M355K probably damaging Het
Map3k11 T G 19: 5,697,402 D555E probably benign Het
Myocd A G 11: 65,196,256 Y282H probably damaging Het
Nae1 T C 8: 104,534,544 I7M probably benign Het
Nprl3 G T 11: 32,255,453 H102N possibly damaging Het
Nup62 T A 7: 44,829,040 F160I possibly damaging Het
Olfr1490 C A 19: 13,654,507 P26Q possibly damaging Het
Olfr456 T A 6: 42,486,654 T180S possibly damaging Het
Olfr502 A G 7: 108,523,738 S71P probably benign Het
Olfr709-ps1 A T 7: 106,926,689 F257I probably benign Het
Olfr781 C A 10: 129,333,202 T107K possibly damaging Het
Osbpl10 T C 9: 115,067,315 probably null Het
Pcdh9 C T 14: 93,885,846 V963I probably benign Het
Phf12 A G 11: 78,018,218 R375G probably benign Het
Piezo1 G A 8: 122,506,269 T108M probably damaging Het
Plxnc1 T A 10: 94,943,773 Q269L probably benign Het
Pomgnt1 T A 4: 116,151,602 N11K possibly damaging Het
Prkd1 A T 12: 50,366,300 probably null Het
Prpf40a T C 2: 53,159,281 T190A probably benign Het
Prrc2b A C 2: 32,212,285 H790P possibly damaging Het
Rest T G 5: 77,281,180 V482G probably benign Het
Ros1 T A 10: 52,163,903 I322L probably benign Het
Rpl18 G A 7: 45,720,130 probably benign Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sbf2 A G 7: 110,441,534 L362S probably damaging Het
Sgsm3 A G 15: 81,009,263 T409A probably benign Het
Slc16a14 T C 1: 84,912,709 T292A possibly damaging Het
Spg11 T G 2: 122,097,356 K649T probably damaging Het
Srprb T A 9: 103,190,216 I268F possibly damaging Het
Tap2 G A 17: 34,214,709 G566S probably damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Tmem181a T A 17: 6,280,615 L50H probably damaging Het
Tshz1 A G 18: 84,014,069 I738T probably damaging Het
Tspan12 T C 6: 21,772,638 E304G probably benign Het
Urb1 C T 16: 90,762,383 G1671S probably damaging Het
Vmn2r2 T C 3: 64,117,361 S600G possibly damaging Het
Wnt3 C A 11: 103,808,174 Y35* probably null Het
Xpo7 T C 14: 70,683,719 Y603C possibly damaging Het
Zfp457 G A 13: 67,293,951 H91Y probably damaging Het
Zfp664 T A 5: 124,886,186 C215S unknown Het
Zfp882 G A 8: 71,914,505 G392D probably benign Het
Other mutations in Tecpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Tecpr2 APN 12 110967779 missense possibly damaging 0.67
IGL01759:Tecpr2 APN 12 110931392 utr 3 prime probably benign
IGL02114:Tecpr2 APN 12 110968887 missense probably damaging 1.00
IGL02813:Tecpr2 APN 12 110933192 missense probably damaging 1.00
IGL02943:Tecpr2 APN 12 110967749 missense probably benign
IGL03085:Tecpr2 APN 12 110954826 splice site probably benign
IGL03290:Tecpr2 APN 12 110967833 missense possibly damaging 0.65
R0362:Tecpr2 UTSW 12 110968940 missense probably damaging 0.96
R0486:Tecpr2 UTSW 12 110896369 missense probably benign 0.01
R0662:Tecpr2 UTSW 12 110896228 missense probably benign 0.02
R0787:Tecpr2 UTSW 12 110946343 missense probably benign 0.30
R1147:Tecpr2 UTSW 12 110941438 splice site probably benign
R1454:Tecpr2 UTSW 12 110968953 missense probably benign 0.00
R1513:Tecpr2 UTSW 12 110954800 missense possibly damaging 0.94
R1567:Tecpr2 UTSW 12 110941596 critical splice donor site probably null
R1569:Tecpr2 UTSW 12 110944887 critical splice donor site probably null
R1818:Tecpr2 UTSW 12 110926454 missense probably damaging 1.00
R1856:Tecpr2 UTSW 12 110933064 missense probably benign
R1897:Tecpr2 UTSW 12 110933247 missense probably benign
R1903:Tecpr2 UTSW 12 110947912 missense probably damaging 0.98
R1939:Tecpr2 UTSW 12 110933169 missense probably damaging 0.98
R1982:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R2073:Tecpr2 UTSW 12 110968429 missense possibly damaging 0.51
R2393:Tecpr2 UTSW 12 110926402 missense probably damaging 0.99
R2443:Tecpr2 UTSW 12 110896325 missense probably damaging 1.00
R2484:Tecpr2 UTSW 12 110933318 missense probably benign
R4564:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R4723:Tecpr2 UTSW 12 110932976 missense probably benign 0.01
R4835:Tecpr2 UTSW 12 110954730 missense probably benign 0.00
R4847:Tecpr2 UTSW 12 110939877 missense probably damaging 1.00
R4911:Tecpr2 UTSW 12 110931487 missense possibly damaging 0.74
R5179:Tecpr2 UTSW 12 110944693 missense possibly damaging 0.63
R5266:Tecpr2 UTSW 12 110915402 missense probably damaging 1.00
R5386:Tecpr2 UTSW 12 110915453 missense probably damaging 1.00
R5486:Tecpr2 UTSW 12 110933015 missense probably benign 0.03
R5490:Tecpr2 UTSW 12 110914684 missense probably damaging 1.00
R5627:Tecpr2 UTSW 12 110941482 missense probably damaging 0.97
R5836:Tecpr2 UTSW 12 110931511 missense possibly damaging 0.76
R6084:Tecpr2 UTSW 12 110929109 missense probably damaging 0.98
R6306:Tecpr2 UTSW 12 110944751 missense probably damaging 1.00
R6563:Tecpr2 UTSW 12 110929087 missense probably benign 0.00
R6936:Tecpr2 UTSW 12 110944863 missense possibly damaging 0.83
R6977:Tecpr2 UTSW 12 110939766 missense probably benign 0.17
R7110:Tecpr2 UTSW 12 110918972 missense probably damaging 1.00
R7132:Tecpr2 UTSW 12 110915372 missense probably damaging 0.97
R7353:Tecpr2 UTSW 12 110967844 missense probably benign 0.06
R7362:Tecpr2 UTSW 12 110941476 missense possibly damaging 0.85
R7366:Tecpr2 UTSW 12 110915480 critical splice donor site probably null
R7404:Tecpr2 UTSW 12 110931604 missense probably benign 0.00
R7478:Tecpr2 UTSW 12 110968439 missense probably benign 0.36
R7774:Tecpr2 UTSW 12 110933172 missense probably benign 0.00
R7997:Tecpr2 UTSW 12 110933603 missense probably benign 0.02
R8037:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
R8038:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
Z1176:Tecpr2 UTSW 12 110896310 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTAGGTTAACAGTGAATCTGAAG -3'
(R):5'- ACTGAGAGCCCTGTGACATG -3'

Sequencing Primer
(F):5'- GTTTAGACACGGTCTCACGTAGC -3'
(R):5'- GAGCCCTGTGACATGCCTAAAG -3'
Posted On2017-07-14