Mutagenetix > Incidental Mutation

Incidental Mutation 'R6702:Ubr3'

528790

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6702 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69956049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 836 (R836W)

Ref Sequence

ENSEMBL: ENSMUSP00000107870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

AlphaFold

Q5U430

Predicted Effect

probably benign
Transcript: ENSMUST00000055758
AA Change: R837W

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: R837W

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112251
AA Change: R836W

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: R836W

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

97% (59/61)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	T	A	10: 21,621,659	Y66*	probably null	Het
2810474O19Rik	T	A	6: 149,327,878	N807K	probably damaging	Het
Ak3	A	G	19: 29,026,227	V183A	probably damaging	Het
Ano10	G	T	9: 122,259,564	Q397K	possibly damaging	Het
Atg7	C	A	6: 114,671,097		probably null	Het
Brpf3	A	C	17: 28,810,659	N531T	probably benign	Het
Casp2	T	C	6: 42,268,051	V128A	probably benign	Het
Cdcp2	T	C	4: 107,107,086	C378R	probably benign	Het
Cfap54	T	A	10: 92,868,734	D2828V	unknown	Het
Col6a3	T	C	1: 90,779,439	D1984G	unknown	Het
Csnk2a1	A	G	2: 152,258,688	T93A	probably benign	Het
Ddx54	T	A	5: 120,626,503	D758E	possibly damaging	Het
Dlx2	A	G	2: 71,546,227	S56P	probably damaging	Het
Dna2	T	A	10: 62,973,294	I1055N	possibly damaging	Het
Dnah10	A	G	5: 124,805,805	Y2909C	probably damaging	Het
Dnm3	A	G	1: 162,318,687	F296L	probably benign	Het
Fat1	A	G	8: 44,953,046	T945A	probably benign	Het
Herpud1	T	C	8: 94,392,526		probably null	Het
Iqub	T	A	6: 24,449,745	N707I	probably damaging	Het
Kif26b	C	G	1: 178,917,287	S1649R	possibly damaging	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Ltbr	A	G	6: 125,308,068	S290P	probably benign	Het
Map4k1	T	G	7: 29,002,396	S803A	possibly damaging	Het
Mef2c	T	A	13: 83,625,406	C134S	possibly damaging	Het
Myo15	A	G	11: 60,492,992	I1622V	probably benign	Het
Nbea	A	G	3: 56,005,502	Y955H	probably benign	Het
Ndor1	A	G	2: 25,249,890	F142S	possibly damaging	Het
Nynrin	A	G	14: 55,864,478	T535A	possibly damaging	Het
Olfr1176	G	A	2: 88,340,242	V226I	probably benign	Het
Olfr1290	T	A	2: 111,490,109		probably null	Het
Olfr205	C	T	16: 59,328,598	V304I	probably benign	Het
Olfr727	A	G	14: 50,127,231	Y218C	probably damaging	Het
Olfr916	A	T	9: 38,657,777	I205N	possibly damaging	Het
Pcdhb13	T	G	18: 37,444,775	H735Q	probably benign	Het
Pcdhb7	A	T	18: 37,341,906	M32L	probably benign	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Per2	C	T	1: 91,427,949	E696K	probably damaging	Het
Pld4	T	C	12: 112,765,051	S213P	probably damaging	Het
Prkg1	T	A	19: 30,993,084	H209L	probably benign	Het
Psg16	T	C	7: 17,090,396	L35P	probably damaging	Het
Pxn	C	T	5: 115,551,896	L160F	probably benign	Het
Rab3a	A	G	8: 70,756,448	D77G	probably damaging	Het
Rgma	A	T	7: 73,417,320	T108S	probably damaging	Het
Rxrg	A	G	1: 167,613,805	S51G	probably benign	Het
S1pr3	A	T	13: 51,419,439	I219F	probably damaging	Het
Sec23b	A	T	2: 144,559,189		probably null	Het
Sfrp5	G	T	19: 42,201,827	T62K	probably benign	Het
Slco1a6	T	A	6: 142,103,100	Y318F	probably damaging	Het
Slit1	A	C	19: 41,614,870	S931A	possibly damaging	Het
Sorl1	A	T	9: 42,071,201	V361E	probably damaging	Het
St6galnac2	A	G	11: 116,684,387	S209P	probably benign	Het
Supt6	C	A	11: 78,231,800	R199L	possibly damaging	Het
Tas2r107	A	C	6: 131,659,384	M234R	probably benign	Het
Tmem72	C	G	6: 116,698,349	V61L	probably benign	Het
Trpm5	C	A	7: 143,069,318		probably benign	Het
Ttn	T	G	2: 76,720,112	T23282P	probably damaging	Het
Ubap2	GCCCGCTTGCCCCGCT	GCCCGCTTGCCCCGCTTGCCCCGCT	4: 41,227,210		probably benign	Het
Umodl1	A	G	17: 30,986,299		probably null	Het
Ythdf1	A	G	2: 180,919,133		probably null	Het
Zfp780b	T	C	7: 27,971,641	T81A	possibly damaging	Het
Zfp811	T	C	17: 32,797,842	E407G	probably damaging	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	splice site	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
R7946:Ubr3	UTSW	2	69951395	missense	possibly damaging	0.95
R7991:Ubr3	UTSW	2	69952856	missense	probably damaging	1.00
R8071:Ubr3	UTSW	2	69988876	missense	probably damaging	0.99
R8136:Ubr3	UTSW	2	70021179	missense	probably damaging	1.00
R8296:Ubr3	UTSW	2	69954362	missense	probably null	1.00
R8313:Ubr3	UTSW	2	69945134	missense	probably damaging	0.99
R8675:Ubr3	UTSW	2	70020521	missense	probably damaging	1.00
R8834:Ubr3	UTSW	2	70003441	missense	probably benign
R8975:Ubr3	UTSW	2	69922307	missense	probably damaging	1.00
R9060:Ubr3	UTSW	2	70009145	nonsense	probably null
R9153:Ubr3	UTSW	2	69965478	missense
R9234:Ubr3	UTSW	2	69897646	missense	probably benign
R9293:Ubr3	UTSW	2	69897425	missense	probably benign	0.02
R9312:Ubr3	UTSW	2	69954333	missense	probably damaging	1.00
R9710:Ubr3	UTSW	2	69897613	missense	possibly damaging	0.94
R9762:Ubr3	UTSW	2	70009153	missense	probably benign	0.00
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	probably benign	0.17
Z1177:Ubr3	UTSW	2	69897666	missense	probably damaging	1.00
Z1177:Ubr3	UTSW	2	69973206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCCAGTCATTTTCTATTTTGGT -3'
(R):5'- CAGAAGAATGCCAAAACTGGATT -3'

Sequencing Primer
(F):5'- GATGCTGGTGCTAGTCATTA -3'
(R):5'- GCCACAGTTAGCCTATTGAGTAAGC -3'

Posted On

2018-07-24