Incidental Mutation 'R6993:Insr'
ID543973
Institutional Source Beutler Lab
Gene Symbol Insr
Ensembl Gene ENSMUSG00000005534
Gene Nameinsulin receptor
SynonymsIR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R6993 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3122061-3279617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3258752 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 95 (G95S)
Ref Sequence ENSEMBL: ENSMUSP00000088837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091291]
PDB Structure
1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000091291
AA Change: G95S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: G95S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Recep_L_domain 52 164 5e-28 PFAM
FU 231 274 1.66e-10 SMART
Pfam:Recep_L_domain 359 473 2.5e-30 PFAM
FN3 496 602 4.02e1 SMART
FN3 624 821 1.16e-6 SMART
FN3 841 924 3.17e-4 SMART
transmembrane domain 947 969 N/A INTRINSIC
TyrKc 1013 1280 3.11e-134 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1327 1336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,248,424 E10G possibly damaging Het
Akap9 A G 5: 4,065,866 I3429V possibly damaging Het
Braf T A 6: 39,643,163 I441F probably damaging Het
C5ar1 A T 7: 16,248,912 V61E probably damaging Het
Camk2a C A 18: 60,943,175 probably benign Het
Cd163 A G 6: 124,317,714 Y579C probably damaging Het
Celf1 T C 2: 91,010,476 Y363H probably damaging Het
Cntn3 T C 6: 102,278,404 T178A probably damaging Het
Cryab C T 9: 50,753,448 P58S probably benign Het
Ctsf G T 19: 4,858,483 R290L probably benign Het
Ctsw T A 19: 5,465,837 I258F probably damaging Het
Dnah7b T C 1: 46,195,139 probably null Het
Drg1 TCATCTTCCA TCA 11: 3,250,294 probably null Het
Etfb A G 7: 43,456,554 T172A possibly damaging Het
Etfdh A G 3: 79,612,031 Y272H probably benign Het
Ewsr1 C T 11: 5,071,573 R454Q probably benign Het
F2rl2 T A 13: 95,701,134 I229N probably damaging Het
Fam162a A T 16: 36,049,845 I88N probably damaging Het
Fastkd5 A G 2: 130,616,539 S44P probably benign Het
Fat3 T G 9: 15,919,221 S4326R probably damaging Het
Fbf1 T C 11: 116,152,784 K400E probably benign Het
Fndc7 A G 3: 108,876,591 V234A probably benign Het
Gfi1 T A 5: 107,717,768 H481L probably damaging Het
Gm5591 T A 7: 38,519,223 H742L probably benign Het
Gm5724 G A 6: 141,765,742 T81I possibly damaging Het
Gm853 A G 4: 130,218,313 L192P probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
H2-DMb1 A C 17: 34,157,350 T148P possibly damaging Het
H2-T3 A G 17: 36,187,070 L317P probably damaging Het
Hes3 T C 4: 152,286,923 T190A probably benign Het
Hivep1 C T 13: 42,158,714 L1477F possibly damaging Het
Irf9 A G 14: 55,608,957 I394V probably benign Het
Kat2b T C 17: 53,638,522 L323P probably damaging Het
Kdr T C 5: 75,972,411 D69G probably benign Het
Krt2 C T 15: 101,815,960 E290K probably damaging Het
Krtap4-6 G T 11: 99,665,719 R61S unknown Het
Lrrc27 A T 7: 139,242,624 K477M probably damaging Het
Lvrn T C 18: 46,882,298 V579A probably benign Het
Malrd1 A T 2: 16,150,791 I2004L unknown Het
Mast4 A T 13: 102,735,974 N2103K probably benign Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Myo18a T A 11: 77,859,074 probably benign Het
Olfr597 G T 7: 103,320,791 probably benign Het
Olfr975 T A 9: 39,950,637 M45L probably benign Het
Pcdhga10 A G 18: 37,749,256 Y690C probably damaging Het
Pdcd2 A G 17: 15,527,081 Y65H probably damaging Het
Ppp1r12a A G 10: 108,240,837 E309G probably benign Het
Psmb8 A G 17: 34,199,643 D123G probably damaging Het
Ptcd3 A T 6: 71,885,315 W513R probably damaging Het
Ptx4 G A 17: 25,124,924 V383I possibly damaging Het
Ric1 T C 19: 29,586,613 L589S probably damaging Het
Rmnd5b A G 11: 51,624,600 probably benign Het
Sec16a A T 2: 26,423,574 S1925T probably damaging Het
Slc16a11 T A 11: 70,216,016 M360K possibly damaging Het
Slc19a2 T A 1: 164,260,822 F79I probably benign Het
Slc2a6 G T 2: 27,027,243 S45R probably damaging Het
Sppl3 T A 5: 115,082,290 M87K probably damaging Het
Tbcel A T 9: 42,416,117 L330* probably null Het
Tbx5 A T 5: 119,871,389 Y321F possibly damaging Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Unc45a A T 7: 80,325,655 Y934N probably damaging Het
Unc80 A T 1: 66,549,793 Q1039L possibly damaging Het
Vmn2r112 T C 17: 22,603,214 L291P probably benign Het
Wwc2 A T 8: 47,847,465 F988I unknown Het
Zfp947 G A 17: 22,145,980 P238S probably benign Het
Other mutations in Insr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Insr APN 8 3258682 missense probably damaging 1.00
IGL01986:Insr APN 8 3158817 missense probably damaging 1.00
IGL02135:Insr APN 8 3258741 missense probably damaging 1.00
IGL02203:Insr APN 8 3155817 missense probably benign 0.18
IGL02220:Insr APN 8 3159578 missense probably damaging 1.00
IGL02678:Insr APN 8 3173570 missense probably benign 0.00
IGL02961:Insr APN 8 3258785 missense probably benign 0.08
IGL03099:Insr APN 8 3258715 missense probably damaging 1.00
IGL03125:Insr APN 8 3184972 missense possibly damaging 0.87
IGL03290:Insr APN 8 3258574 missense probably damaging 1.00
gummi_bear UTSW 8 3161770 missense probably damaging 1.00
Patently UTSW 8 3159475 missense probably damaging 1.00
trolli UTSW 8 3198111 missense probably benign 0.31
R0047:Insr UTSW 8 3202947 missense probably damaging 0.97
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0480:Insr UTSW 8 3161770 missense probably damaging 1.00
R0748:Insr UTSW 8 3258841 missense probably damaging 1.00
R0919:Insr UTSW 8 3158769 missense probably damaging 1.00
R1348:Insr UTSW 8 3192635 missense probably damaging 1.00
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1568:Insr UTSW 8 3165576 missense probably benign
R1768:Insr UTSW 8 3159561 missense probably damaging 1.00
R2093:Insr UTSW 8 3204762 missense probably damaging 1.00
R2111:Insr UTSW 8 3169748 missense probably benign 0.17
R2112:Insr UTSW 8 3169748 missense probably benign 0.17
R2352:Insr UTSW 8 3192593 missense probably damaging 1.00
R2364:Insr UTSW 8 3174820 missense probably benign
R2842:Insr UTSW 8 3202986 missense probably damaging 1.00
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R4081:Insr UTSW 8 3211391 missense probably benign 0.00
R4441:Insr UTSW 8 3194902 missense probably benign 0.00
R4672:Insr UTSW 8 3167501 critical splice donor site probably null
R4687:Insr UTSW 8 3161709 missense probably benign 0.42
R4708:Insr UTSW 8 3211346 intron probably benign
R4890:Insr UTSW 8 3198234 missense probably benign 0.16
R4949:Insr UTSW 8 3185059 missense probably benign 0.04
R4996:Insr UTSW 8 3192665 missense probably null 0.98
R5073:Insr UTSW 8 3159475 missense probably damaging 1.00
R5176:Insr UTSW 8 3158742 missense probably benign 0.03
R5200:Insr UTSW 8 3198059 critical splice donor site probably null
R5323:Insr UTSW 8 3202902 missense probably benign 0.02
R5453:Insr UTSW 8 3155694 missense probably benign 0.06
R5516:Insr UTSW 8 3155764 nonsense probably null
R5704:Insr UTSW 8 3185122 missense possibly damaging 0.52
R5820:Insr UTSW 8 3155976 missense probably damaging 1.00
R5879:Insr UTSW 8 3198173 nonsense probably null
R5894:Insr UTSW 8 3174869 missense possibly damaging 0.88
R5937:Insr UTSW 8 3174808 missense probably benign
R5966:Insr UTSW 8 3258697 missense probably benign 0.04
R6134:Insr UTSW 8 3192572 missense probably damaging 1.00
R6352:Insr UTSW 8 3173479 critical splice donor site probably null
R6423:Insr UTSW 8 3173566 missense probably benign
R6687:Insr UTSW 8 3198111 missense probably benign 0.31
R6985:Insr UTSW 8 3161372 missense possibly damaging 0.87
R7041:Insr UTSW 8 3258418 missense probably benign
R7109:Insr UTSW 8 3258481 missense probably benign 0.33
R7216:Insr UTSW 8 3203034 missense possibly damaging 0.53
R7287:Insr UTSW 8 3169717 missense probably benign 0.00
R7378:Insr UTSW 8 3198231 missense probably damaging 1.00
R7525:Insr UTSW 8 3192642 missense probably damaging 1.00
R7572:Insr UTSW 8 3173602 missense probably benign 0.11
R7636:Insr UTSW 8 3258709 missense probably damaging 1.00
R7684:Insr UTSW 8 3169753 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTTGTCCTCCACAGAATCCAG -3'
(R):5'- TATGGACATCCGGAACAACCTG -3'

Sequencing Primer
(F):5'- GCCAGGTAGCAGAGCTCATTATTC -3'
(R):5'- TCCGGAACAACCTGACCAG -3'
Posted On2019-05-13