Incidental Mutation 'R7077:Eif4ebp2'
ID549284
Institutional Source Beutler Lab
Gene Symbol Eif4ebp2
Ensembl Gene ENSMUSG00000020091
Gene Nameeukaryotic translation initiation factor 4E binding protein 2
Synonyms2810011I19Rik, 4E-BP2, PHAS-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location61428491-61452661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 61433801 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 120 (I120S)
Ref Sequence ENSEMBL: ENSMUSP00000020288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020288] [ENSMUST00000167087]
Predicted Effect probably damaging
Transcript: ENSMUST00000020288
AA Change: I120S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020288
Gene: ENSMUSG00000020091
AA Change: I120S

DomainStartEndE-ValueType
Pfam:eIF_4EBP 1 120 4.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167087
AA Change: I120S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131952
Gene: ENSMUSG00000020091
AA Change: I120S

DomainStartEndE-ValueType
Pfam:eIF_4EBP 1 120 4.2e-51 PFAM
Meta Mutation Damage Score 0.6111 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eukaryotic translation initiation factor 4E binding protein family. The gene products of this family bind eIF4E and inhibit translation initiation. However, insulin and other growth factors can release this inhibition via a phosphorylation-dependent disruption of their binding to eIF4E. Regulation of protein production through these gene products have been implicated in cell proliferation, cell differentiation and viral infection. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display altered synaptic transmission, impaired spatial learning, and long-term memory deficits, and autism-like behaviors including abnormal social investigation, repetitive behaviors and abnormal vocalization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Eif4ebp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03180:Eif4ebp2 APN 10 61433810 missense probably damaging 1.00
R7836:Eif4ebp2 UTSW 10 61434993 missense probably benign
R7919:Eif4ebp2 UTSW 10 61434993 missense probably benign
R8030:Eif4ebp2 UTSW 10 61435046 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTGGACTGGTCAGCTC -3'
(R):5'- AGTATTGCACTCAGGAATAGGTG -3'

Sequencing Primer
(F):5'- CCTAACCTTAACTGGGCAGAGG -3'
(R):5'- CACTCAGGAATAGGTGTCTGAGGTC -3'
Posted On2019-05-15