Incidental Mutation 'PIT4486001:Actl9'
ID556131
Institutional Source Beutler Lab
Gene Symbol Actl9
Ensembl Gene ENSMUSG00000092519
Gene Nameactin-like 9
Synonyms1700029I08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4486001 (G1)
Quality Score181.009
Status Not validated
Chromosome17
Chromosomal Location33432896-33434268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33434198 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 411 (Y411N)
Ref Sequence ENSEMBL: ENSMUSP00000134564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000174088
AA Change: Y411N

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134564
Gene: ENSMUSG00000092519
AA Change: Y411N

DomainStartEndE-ValueType
ACTIN 48 415 6.36e-112 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Actl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Actl9 APN 17 33434178 missense probably damaging 1.00
IGL01990:Actl9 APN 17 33434094 missense probably benign 0.09
IGL02691:Actl9 APN 17 33433118 missense probably damaging 0.99
IGL02930:Actl9 APN 17 33434099 missense probably damaging 1.00
nerva UTSW 17 33433122 missense probably damaging 1.00
R0523:Actl9 UTSW 17 33433349 missense probably damaging 1.00
R0606:Actl9 UTSW 17 33433598 missense probably damaging 1.00
R1545:Actl9 UTSW 17 33433257 missense probably damaging 1.00
R1732:Actl9 UTSW 17 33433122 missense probably damaging 1.00
R3958:Actl9 UTSW 17 33433764 missense probably benign 0.09
R4701:Actl9 UTSW 17 33433935 missense probably benign 0.26
R4943:Actl9 UTSW 17 33433085 missense possibly damaging 0.95
R4971:Actl9 UTSW 17 33433908 missense probably damaging 1.00
R5032:Actl9 UTSW 17 33434088 missense probably benign 0.04
R5236:Actl9 UTSW 17 33434099 missense probably damaging 1.00
R5782:Actl9 UTSW 17 33433761 missense probably benign 0.00
R6127:Actl9 UTSW 17 33433380 missense probably benign 0.03
R6808:Actl9 UTSW 17 33433124 missense probably damaging 1.00
R6899:Actl9 UTSW 17 33433559 missense probably damaging 1.00
R7657:Actl9 UTSW 17 33433040 missense probably benign 0.04
R7663:Actl9 UTSW 17 33433469 missense probably damaging 1.00
R7905:Actl9 UTSW 17 33433827 missense possibly damaging 0.92
X0062:Actl9 UTSW 17 33433128 missense probably damaging 1.00
Z1176:Actl9 UTSW 17 33433101 missense possibly damaging 0.95
Z1177:Actl9 UTSW 17 33433113 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGGCCCGGAATGTGATAC -3'
(R):5'- ACTAATTTGAGTCAGGGATGCTTG -3'

Sequencing Primer
(F):5'- GCCCGGAATGTGATACTATGC -3'
(R):5'- AGAAGTTCCCACGGGTGTG -3'
Posted On2019-06-07