Incidental Mutation 'PIT4486001:Uimc1'
ID556124
Institutional Source Beutler Lab
Gene Symbol Uimc1
Ensembl Gene ENSMUSG00000025878
Gene Nameubiquitin interaction motif containing 1
SynonymsD330018D10Rik, D630032M02Rik, Rxrip110, 9430016E08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55027880-55100300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55075568 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 297 (L297P)
Ref Sequence ENSEMBL: ENSMUSP00000026997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026997] [ENSMUST00000099496] [ENSMUST00000127195] [ENSMUST00000148702]
Predicted Effect probably damaging
Transcript: ENSMUST00000026997
AA Change: L297P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026997
Gene: ENSMUSG00000025878
AA Change: L297P

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099496
SMART Domains Protein: ENSMUSP00000097095
Gene: ENSMUSG00000025878

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 1.53e1 SMART
low complexity region 433 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127195
AA Change: L297P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122196
Gene: ENSMUSG00000025878
AA Change: L297P

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148702
AA Change: L297P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120935
Gene: ENSMUSG00000025878
AA Change: L297P

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death due to B-cell lymphomas and abnormal DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Uimc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Uimc1 APN 13 55034911 missense probably benign 0.05
IGL01655:Uimc1 APN 13 55028704 missense probably benign 0.11
IGL01867:Uimc1 APN 13 55075401 missense probably benign
IGL02512:Uimc1 APN 13 55040618 missense possibly damaging 0.66
IGL02704:Uimc1 APN 13 55030959 missense probably benign 0.01
PIT4382001:Uimc1 UTSW 13 55031015 missense probably benign 0.00
R0118:Uimc1 UTSW 13 55085644 missense probably damaging 0.99
R0349:Uimc1 UTSW 13 55075991 missense probably benign 0.11
R0441:Uimc1 UTSW 13 55093219 missense probably damaging 1.00
R0634:Uimc1 UTSW 13 55060266 missense possibly damaging 0.66
R0834:Uimc1 UTSW 13 55076409 critical splice acceptor site probably null
R1175:Uimc1 UTSW 13 55028602 missense possibly damaging 0.92
R2243:Uimc1 UTSW 13 55050739 critical splice donor site probably null
R2566:Uimc1 UTSW 13 55075804 missense probably damaging 1.00
R4435:Uimc1 UTSW 13 55075823 missense probably damaging 0.96
R4622:Uimc1 UTSW 13 55077494 missense probably damaging 1.00
R4935:Uimc1 UTSW 13 55093185 missense probably damaging 0.97
R5140:Uimc1 UTSW 13 55075517 missense probably damaging 1.00
R5466:Uimc1 UTSW 13 55075848 missense probably damaging 1.00
R6395:Uimc1 UTSW 13 55040576 missense possibly damaging 0.66
R6955:Uimc1 UTSW 13 55040546 missense possibly damaging 0.86
R7040:Uimc1 UTSW 13 55075454 intron probably null
R7106:Uimc1 UTSW 13 55050815 missense possibly damaging 0.83
R7505:Uimc1 UTSW 13 55075631 missense probably damaging 1.00
R7864:Uimc1 UTSW 13 55093267 nonsense probably null
R7872:Uimc1 UTSW 13 55069737 missense possibly damaging 0.78
R7947:Uimc1 UTSW 13 55093267 nonsense probably null
R7955:Uimc1 UTSW 13 55069737 missense possibly damaging 0.78
RF009:Uimc1 UTSW 13 55050785 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACAGATGCCCTAGATTCCTGC -3'
(R):5'- AAAGTACTGGGAGTGGTTATGC -3'

Sequencing Primer
(F):5'- AGATGCCCTAGATTCCTGCCTTTC -3'
(R):5'- CTTTTTCCAAAGCTGTCCAGGGTAG -3'
Posted On2019-06-07