Mutagenetix > Incidental Mutation

Incidental Mutation 'R0594:Grin2b'

56113

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

038784-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135733929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 873 (H873R)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: H873R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: H873R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: H873R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: H873R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136027

Meta Mutation Damage Score

0.5563

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.6%

Validation Efficiency

99% (119/120)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	T	C	16: 14,389,880	V41A	probably benign	Het
Acad11	A	G	9: 104,095,563	Q367R	probably benign	Het
Ackr4	A	G	9: 104,099,004	V248A	possibly damaging	Het
Adamts14	T	C	10: 61,202,887	E945G	probably damaging	Het
Akap2	A	G	4: 57,856,752	T694A	probably benign	Het
Ano2	A	G	6: 125,982,765	M663V	probably damaging	Het
Apc2	T	A	10: 80,306,256	C336*	probably null	Het
Arhgap17	A	G	7: 123,294,518	S560P	probably benign	Het
Arl5a	T	C	2: 52,405,014	D128G	probably damaging	Het
Atp6v0a2	C	A	5: 124,717,982	R678S	probably benign	Het
B4galnt2	C	A	11: 95,891,909	A26S	probably benign	Het
C1qtnf1	A	T	11: 118,446,628	T95S	possibly damaging	Het
Ccdc188	T	A	16: 18,218,920	F241L	probably benign	Het
Cdh19	A	T	1: 110,925,867	D281E	probably benign	Het
Cdk5rap2	T	C	4: 70,354,813	E241G	probably damaging	Het
Cherp	A	T	8: 72,462,402		probably null	Het
Cpne9	T	A	6: 113,290,400		probably benign	Het
Cthrc1	A	T	15: 39,077,142	R47W	possibly damaging	Het
Dcaf13	A	G	15: 39,123,268	E145G	probably benign	Het
Dcaf4	T	A	12: 83,538,043		probably null	Het
Dgka	A	C	10: 128,733,110		probably benign	Het
Dhrs13	T	A	11: 78,034,525	F157L	probably damaging	Het
Dnajb5	A	T	4: 42,956,577	Y88F	probably damaging	Het
Dpp8	A	G	9: 65,036,998	T16A	probably damaging	Het
Dscc1	A	T	15: 55,089,052	I91K	possibly damaging	Het
Efemp2	T	A	19: 5,475,063		probably benign	Het
Elf2	T	C	3: 51,256,453	T504A	possibly damaging	Het
Elk3	G	A	10: 93,265,160	S243F	probably damaging	Het
Ell2	A	G	13: 75,749,993	D93G	probably damaging	Het
Eln	G	T	5: 134,712,398		probably benign	Het
Eme1	C	T	11: 94,650,430	D189N	possibly damaging	Het
Epb41l2	A	G	10: 25,443,770	E167G	possibly damaging	Het
Exoc5	A	T	14: 49,036,087		probably benign	Het
Fam129c	C	A	8: 71,599,135	A38E	probably benign	Het
Fam170b	A	G	14: 32,836,314	K369E	unknown	Het
Fam187b	T	A	7: 30,977,154	C29*	probably null	Het
Fam20c	T	C	5: 138,766,637	S260P	possibly damaging	Het
Fam216b	G	A	14: 78,086,674	A21V	possibly damaging	Het
Fam98a	A	T	17: 75,538,487	Y421*	probably null	Het
Farp2	T	C	1: 93,576,500	V333A	probably damaging	Het
Fcgr1	T	C	3: 96,292,312	Y93C	probably damaging	Het
Fgd2	A	T	17: 29,365,552	I157F	probably damaging	Het
Frmd4b	T	A	6: 97,325,426		probably benign	Het
Fut9	T	C	4: 25,620,526	D96G	possibly damaging	Het
Glt8d1	G	A	14: 31,010,410		probably null	Het
Gm7579	T	A	7: 142,212,384	C176S	unknown	Het
Gmpr2	A	G	14: 55,677,988	E272G	probably damaging	Het
Gtf2i	C	T	5: 134,242,173		probably benign	Het
Htr3b	A	T	9: 48,947,631	V69E	probably benign	Het
Icam5	A	G	9: 21,035,598	N474S	probably benign	Het
Itgal	T	A	7: 127,314,060	S610T	probably damaging	Het
Jag1	T	A	2: 137,087,080	I819L	probably damaging	Het
Kif9	A	T	9: 110,511,340	E467V	probably benign	Het
Krit1	T	C	5: 3,823,694	L491P	possibly damaging	Het
Lipo2	T	G	19: 33,746,902	I155L	possibly damaging	Het
Lmbr1	A	G	5: 29,292,209	F65L	possibly damaging	Het
Lsp1	G	A	7: 142,488,950		probably benign	Het
Marc2	T	C	1: 184,841,339	N121D	probably benign	Het
Mgat5	T	A	1: 127,412,248	D455E	probably damaging	Het
Mical2	A	T	7: 112,318,450	Y338F	probably damaging	Het
Mkl1	G	A	15: 81,017,174	T372I	probably damaging	Het
Mre11a	T	G	9: 14,815,209	S396A	probably benign	Het
Myo3a	C	T	2: 22,544,332		probably benign	Het
Naca	T	C	10: 128,040,355		probably benign	Het
Nav1	A	T	1: 135,467,643	I996K	possibly damaging	Het
Ncbp1	A	G	4: 46,170,551	N742S	probably benign	Het
Ndufaf3	G	A	9: 108,566,923	A2V	probably benign	Het
Ntn5	G	T	7: 45,686,681	A47S	probably damaging	Het
Olfr1122	T	A	2: 87,387,954	I83N	probably damaging	Het
Olfr13	T	A	6: 43,174,607	V207E	possibly damaging	Het
Olfr1502	G	T	19: 13,862,279	C162F	probably benign	Het
Olfr384	G	A	11: 73,603,392	E271K	probably benign	Het
Olfr392	T	C	11: 73,814,617	H155R	probably benign	Het
Olfr777	T	C	10: 129,269,152	Y57C	possibly damaging	Het
Otud7a	T	A	7: 63,727,472	L203*	probably null	Het
Pcdhb13	A	G	18: 37,443,931	Y454C	probably damaging	Het
Pdzph1	C	T	17: 58,954,479	V853M	possibly damaging	Het
Plec	A	G	15: 76,172,253	S4517P	probably damaging	Het
Pm20d2	C	T	4: 33,181,746	E286K	probably damaging	Het
Polr2i	T	A	7: 30,232,745		probably null	Het
Ppp1r12b	A	G	1: 134,776,479	L879P	probably damaging	Het
Prf1	C	A	10: 61,303,722	Y486*	probably null	Het
Qsox2	T	G	2: 26,214,044	T325P	probably damaging	Het
Rab1b	G	T	19: 5,100,656		probably benign	Het
Rbm19	T	C	5: 120,128,316		probably null	Het
Rhobtb2	A	G	14: 69,793,948	V576A	probably benign	Het
Rnps1	G	A	17: 24,424,437	V215M	probably damaging	Het
Rps11	A	G	7: 45,124,282		probably benign	Het
Serpinb3d	C	T	1: 107,079,347	M210I	probably damaging	Het
Sgsm1	T	C	5: 113,310,562	T17A	probably benign	Het
Slc6a3	A	G	13: 73,538,642	T43A	probably damaging	Het
Sox4	C	G	13: 28,952,904	A40P	probably damaging	Het
Spry2	A	T	14: 105,893,310	D147E	possibly damaging	Het
Stpg1	A	G	4: 135,519,431	N157D	possibly damaging	Het
Sumf1	T	C	6: 108,173,414	D152G	probably benign	Het
Tbr1	T	C	2: 61,811,620	S410P	possibly damaging	Het
Tdrd6	A	G	17: 43,629,383	V258A	probably damaging	Het
Tirap	C	T	9: 35,188,761	G209D	probably damaging	Het
Tnfrsf8	A	T	4: 145,296,861	V134D	probably damaging	Het
Tnr	A	G	1: 159,850,335	T97A	probably benign	Het
Tspan32	T	A	7: 143,015,610	F135L	probably damaging	Het
Ttn	T	C	2: 76,789,056	K16021E	probably damaging	Het
Tusc3	T	A	8: 39,096,968	I251N	probably damaging	Het
Usp38	A	T	8: 81,005,366	I305N	probably damaging	Het
Usp4	T	A	9: 108,370,881		probably null	Het
Usp5	A	T	6: 124,817,424	D764E	probably damaging	Het
Vangl2	A	T	1: 172,004,657	V544E	probably damaging	Het
Vldlr	G	A	19: 27,234,819	V78M	probably damaging	Het
Vmn1r29	T	C	6: 58,307,772	V159A	probably benign	Het
Vmn2r16	T	A	5: 109,363,896	F656L	probably damaging	Het
Wdfy3	T	A	5: 101,906,185	I1590F	possibly damaging	Het
Xpo1	T	A	11: 23,280,402	V263E	probably damaging	Het
Zbtb38	A	G	9: 96,685,954	S1026P	probably damaging	Het
Zfp407	A	T	18: 84,562,567	D140E	possibly damaging	Het
Zfp637	T	A	6: 117,845,686	Y258*	probably null	Het
Zfp951	T	A	5: 104,814,572	Q376L	possibly damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGGTCTTGGTACACATTGCTGTCC -3'
(R):5'- AGCAAACTGCCTGCCTCACGATTC -3'

Sequencing Primer
(F):5'- ACGACTTGCAGTCTGAATGC -3'
(R):5'- GCCTCACGATTCTCCTATCTTTG -3'

Posted On

2013-07-11