Incidental Mutation 'R7268:Alb'
ID565065
Institutional Source Beutler Lab
Gene Symbol Alb
Ensembl Gene ENSMUSG00000029368
Gene Namealbumin
SynonymsAlb1, Alb-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7268 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location90460897-90476602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90462716 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 52 (S52T)
Ref Sequence ENSEMBL: ENSMUSP00000031314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031314]
Predicted Effect probably benign
Transcript: ENSMUST00000031314
AA Change: S52T

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031314
Gene: ENSMUSG00000029368
AA Change: S52T

DomainStartEndE-ValueType
ALBUMIN 20 205 1.54e-84 SMART
ALBUMIN 212 397 3.43e-82 SMART
ALBUMIN 404 595 1.51e-83 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: This gene encodes albumin, an abundant plasma protein essential for maintaining oncotic pressure that functions as a carrier protein for various molecules such as steriods and fatty acids in blood. This gene is primarily expressed in liver where the encoded protein undergoes proteolytic processing before secretion into the plasma. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a TALEN-mediated deletion exhibit analbuminemia but appear healthy and grossly normal and breed normally. Mice heterozygotes for an ENU-induced point mutation have significantly reduced plasma albumin and calcium levels and significantly elevated alkaline phosphatase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abl2 T C 1: 156,633,939 probably null Het
Acsf3 A G 8: 122,790,662 Y399C probably benign Het
Acsm5 A T 7: 119,537,288 T361S probably benign Het
Agap1 T G 1: 89,766,348 I456S probably benign Het
Ahnak2 A T 12: 112,780,802 V70E Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Armt1 G A 10: 4,450,855 V201M possibly damaging Het
Atp2a2 T C 5: 122,467,729 T388A probably benign Het
Atp6v0a2 T C 5: 124,719,866 L770P probably damaging Het
B4galnt3 A T 6: 120,215,042 W578R possibly damaging Het
Babam2 T C 5: 31,701,853 S2P probably damaging Het
Baz2a A G 10: 128,124,221 H1459R possibly damaging Het
Bbs7 C T 3: 36,604,426 R233Q probably benign Het
Cacna2d1 G A 5: 16,370,588 G1076R probably damaging Het
Camsap2 C T 1: 136,273,745 probably null Het
Car10 A G 11: 93,599,251 N273D probably benign Het
Ccdc66 T C 14: 27,486,923 D458G probably benign Het
Ccdc7a T A 8: 128,881,152 H982L possibly damaging Het
Col9a1 A G 1: 24,207,398 K386E possibly damaging Het
Ctcfl A G 2: 173,107,795 I415T probably benign Het
Cyp3a16 G C 5: 145,467,470 Y54* probably null Het
Dact2 T C 17: 14,196,535 T468A probably benign Het
Dgkb T A 12: 38,147,555 L355* probably null Het
Dhx40 A T 11: 86,806,616 C42S possibly damaging Het
Dopey1 G T 9: 86,512,777 E637* probably null Het
Dpp4 G T 2: 62,347,842 P649T probably damaging Het
Eri3 T A 4: 117,649,383 I303K probably benign Het
Foxi1 A T 11: 34,205,783 Y282* probably null Het
Gdi2 T A 13: 3,556,363 Y146* probably null Het
Gns A G 10: 121,376,652 Y173C probably damaging Het
Gpc1 C A 1: 92,858,371 P494Q possibly damaging Het
Habp2 G T 19: 56,314,086 G274V probably damaging Het
Hcfc2 T A 10: 82,709,012 Y159* probably null Het
Hmcn2 T A 2: 31,457,966 S4875T possibly damaging Het
Hmgcs2 A G 3: 98,297,480 N318S probably benign Het
Lnpep A T 17: 17,538,541 M847K probably benign Het
Mmp16 A C 4: 18,093,366 M374L probably benign Het
Mrpl38 A G 11: 116,138,570 I40T possibly damaging Het
Ncstn T C 1: 172,081,263 T46A possibly damaging Het
Nlrp1a C T 11: 71,124,242 V61I probably benign Het
Npas2 G T 1: 39,287,577 V48L probably damaging Het
Olfr1339 A G 4: 118,735,408 Y293C probably damaging Het
Olfr655 G A 7: 104,597,077 L35F probably benign Het
Olfr782 C T 10: 129,351,394 T277I possibly damaging Het
Pcyox1 A T 6: 86,391,731 N268K possibly damaging Het
Pramef17 A T 4: 143,993,520 probably null Het
Prr27 T C 5: 87,843,276 L249P probably damaging Het
Psat1 A T 19: 15,917,144 V168D probably damaging Het
Psg17 G T 7: 18,814,661 T395K possibly damaging Het
Ptgis A G 2: 167,206,756 Y447H probably benign Het
Rad50 T A 11: 53,684,275 N607I probably benign Het
Rps6ka2 T C 17: 7,295,263 Y602H possibly damaging Het
Senp6 G A 9: 80,142,124 R1010H probably damaging Het
Slc8a3 C A 12: 81,315,053 D331Y probably damaging Het
Slc9c1 G A 16: 45,550,116 S240N probably damaging Het
Slf1 A G 13: 77,066,707 L620P probably damaging Het
Snx19 A G 9: 30,440,177 E847G probably damaging Het
Spaca6 T C 17: 17,832,107 V103A probably benign Het
Tbk1 A G 10: 121,552,499 Y591H probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tfap2a G A 13: 40,728,760 T15I possibly damaging Het
Tgm2 G A 2: 158,120,268 R544* probably null Het
Tmem116 T A 5: 121,467,855 I90K Het
Tmem30c A C 16: 57,266,414 L342R probably damaging Het
Trpm6 C T 19: 18,778,585 T64I probably benign Het
Ttll8 A G 15: 88,934,956 probably null Het
Vcpip1 A G 1: 9,746,082 I692T probably damaging Het
Vmn1r169 T G 7: 23,577,428 F82V probably benign Het
Vmn1r178 G A 7: 23,893,953 C142Y probably benign Het
Vmn2r16 T A 5: 109,340,465 Y401* probably null Het
Wdr91 A G 6: 34,892,440 V383A probably benign Het
Other mutations in Alb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Alb APN 5 90472073 missense probably benign 0.00
IGL01508:Alb APN 5 90470838 missense probably benign 0.19
IGL01722:Alb APN 5 90470839 critical splice donor site probably null
IGL02103:Alb APN 5 90464131 missense probably benign 0.00
IGL02379:Alb APN 5 90465879 missense probably benign 0.00
IGL02531:Alb APN 5 90467448 missense probably damaging 1.00
IGL02704:Alb APN 5 90468509 missense possibly damaging 0.82
IGL02828:Alb APN 5 90467388 missense probably benign 0.17
IGL03248:Alb APN 5 90461714 splice site probably benign
R0714:Alb UTSW 5 90462806 missense possibly damaging 0.81
R1418:Alb UTSW 5 90464202 splice site probably benign
R1708:Alb UTSW 5 90464051 missense possibly damaging 0.73
R2092:Alb UTSW 5 90463983 frame shift probably null
R4473:Alb UTSW 5 90464053 missense probably damaging 1.00
R4670:Alb UTSW 5 90462806 missense probably benign 0.00
R4758:Alb UTSW 5 90468593 missense probably benign 0.00
R5583:Alb UTSW 5 90468593 missense probably benign 0.00
R6384:Alb UTSW 5 90472640 missense possibly damaging 0.67
R7295:Alb UTSW 5 90462834 critical splice donor site probably null
R7320:Alb UTSW 5 90464987 critical splice donor site probably null
R7337:Alb UTSW 5 90474593 missense probably damaging 1.00
R7505:Alb UTSW 5 90469509 missense probably damaging 1.00
R7575:Alb UTSW 5 90465929 missense probably damaging 1.00
R7651:Alb UTSW 5 90467355 missense probably damaging 1.00
R7652:Alb UTSW 5 90467355 missense probably damaging 1.00
R7654:Alb UTSW 5 90467355 missense probably damaging 1.00
R7669:Alb UTSW 5 90463991 missense possibly damaging 0.93
R7870:Alb UTSW 5 90472629 missense possibly damaging 0.96
R7879:Alb UTSW 5 90472648 missense probably benign 0.21
R7953:Alb UTSW 5 90472629 missense possibly damaging 0.96
R7962:Alb UTSW 5 90472648 missense probably benign 0.21
Z1177:Alb UTSW 5 90468512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGCACTTCAGCATGGTAG -3'
(R):5'- GGCTTTGAAACAGAGTTCCAG -3'

Sequencing Primer
(F):5'- CTGCACTTCAGCATGGTAGAAGTC -3'
(R):5'- CTTTGAAACAGAGTTCCAGAAAGC -3'
Posted On2019-06-26