Incidental Mutation 'R7314:Adss'
ID567811
Institutional Source Beutler Lab
Gene Symbol Adss
Ensembl Gene ENSMUSG00000015961
Gene Nameadenylosuccinate synthetase, non muscle
SynonymsAS
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location177762962-177796511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 177767751 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 408 (W408R)
Ref Sequence ENSEMBL: ENSMUSP00000016105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016105]
Predicted Effect probably damaging
Transcript: ENSMUST00000016105
AA Change: W408R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016105
Gene: ENSMUSG00000015961
AA Change: W408R

DomainStartEndE-ValueType
Adenylsucc_synt 30 454 7e-252 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme adenylosuccinate synthetase which catalyzes the first committed step in the conversion of inosine monophosphate to adenosine monophosphate. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Phkb A G 8: 85,942,392 probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Adss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Adss APN 1 177784942 missense probably damaging 0.99
IGL01770:Adss APN 1 177776509 missense possibly damaging 0.58
IGL02511:Adss APN 1 177771134 splice site probably benign
R0087:Adss UTSW 1 177771222 missense probably benign 0.05
R0607:Adss UTSW 1 177767687 missense possibly damaging 0.72
R1496:Adss UTSW 1 177772194 missense probably benign 0.13
R1888:Adss UTSW 1 177784951 nonsense probably null
R1888:Adss UTSW 1 177784951 nonsense probably null
R1958:Adss UTSW 1 177769978 missense probably damaging 1.00
R2867:Adss UTSW 1 177767812 splice site probably null
R2867:Adss UTSW 1 177767812 splice site probably null
R3886:Adss UTSW 1 177767769 missense probably damaging 1.00
R3888:Adss UTSW 1 177767769 missense probably damaging 1.00
R4288:Adss UTSW 1 177776512 missense probably damaging 1.00
R5373:Adss UTSW 1 177796388 missense probably benign
R5374:Adss UTSW 1 177796388 missense probably benign
R5729:Adss UTSW 1 177796258 missense possibly damaging 0.92
R6244:Adss UTSW 1 177776829 missense probably benign 0.00
R6314:Adss UTSW 1 177767768 missense probably damaging 1.00
R6777:Adss UTSW 1 177776336 splice site probably null
R7577:Adss UTSW 1 177767697 nonsense probably null
R7748:Adss UTSW 1 177772202 nonsense probably null
R7764:Adss UTSW 1 177764261 missense probably damaging 0.98
R8171:Adss UTSW 1 177796351 missense probably benign 0.00
Z1176:Adss UTSW 1 177776493 missense probably damaging 1.00
Z1176:Adss UTSW 1 177796498 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GACAAGAGTCAACATCCCAGGG -3'
(R):5'- GACACAAGTCTGGTTTTGAGG -3'

Sequencing Primer
(F):5'- GAGTCAACATCCCAGGGAAATC -3'
(R):5'- ATCCCAGGATTTGCATAGGC -3'
Posted On2019-06-26