Incidental Mutation 'R7331:Fastkd5'
ID569224
Institutional Source Beutler Lab
Gene Symbol Fastkd5
Ensembl Gene ENSMUSG00000079043
Gene NameFAST kinase domains 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R7331 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location130613840-130630027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130615727 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 314 (N314K)
Ref Sequence ENSEMBL: ENSMUSP00000105891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028761] [ENSMUST00000110262] [ENSMUST00000140581] [ENSMUST00000179273]
Predicted Effect probably benign
Transcript: ENSMUST00000028761
SMART Domains Protein: ENSMUSP00000028761
Gene: ENSMUSG00000027300

DomainStartEndE-ValueType
Ubox 262 331 4.47e-15 SMART
low complexity region 371 395 N/A INTRINSIC
RING 481 525 3.14e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110262
AA Change: N314K

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105891
Gene: ENSMUSG00000079043
AA Change: N314K

DomainStartEndE-ValueType
Pfam:FAST_1 475 544 6e-22 PFAM
Pfam:FAST_2 555 646 7.2e-25 PFAM
RAP 742 801 6.92e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140581
AA Change: N314K

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114878
Gene: ENSMUSG00000027300
AA Change: N314K

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 2.6e-27 PFAM
Pfam:FAST_2 553 598 2.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179273
AA Change: N314K

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137385
Gene: ENSMUSG00000079043
AA Change: N314K

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 1.5e-26 PFAM
Pfam:FAST_2 553 646 4.4e-29 PFAM
RAP 742 801 6.92e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,609 H47L possibly damaging Het
Adgrf5 T C 17: 43,437,593 S438P probably damaging Het
Atg16l2 C A 7: 101,299,048 K96N probably damaging Het
Bglap2 A T 3: 88,378,260 M35K possibly damaging Het
Btbd1 T A 7: 81,815,972 I209L probably damaging Het
Cdc34 T C 10: 79,685,312 Y148H probably damaging Het
Clcc1 A G 3: 108,668,078 D157G probably damaging Het
Csmd2 A T 4: 128,564,228 probably null Het
Ctsj G A 13: 61,003,831 S90L probably benign Het
Cycs A G 6: 50,565,552 F37L probably benign Het
Dync2li1 T A 17: 84,647,658 C248* probably null Het
Dzank1 A T 2: 144,490,270 I382N probably benign Het
Enpp2 T C 15: 54,875,670 I406V probably damaging Het
Ero1lb A G 13: 12,600,126 E282G probably damaging Het
Fam192a T A 8: 94,582,936 K143* probably null Het
Fbxo18 A T 2: 11,763,986 C300S probably benign Het
Fchsd1 T C 18: 37,968,770 I49V possibly damaging Het
Foxn1 A G 11: 78,358,789 Y637H probably damaging Het
Gabarap A G 11: 69,994,472 E101G possibly damaging Het
Gm5580 G A 6: 116,552,169 V336I probably benign Het
Gm7247 A G 14: 51,364,335 R22G probably damaging Het
Gm7694 A T 1: 170,301,611 D116E possibly damaging Het
Gm9508 A G 10: 77,696,795 C147R unknown Het
Gpr152 A G 19: 4,142,609 M50V probably damaging Het
Hunk T A 16: 90,472,562 N331K possibly damaging Het
Il1r2 A G 1: 40,123,249 T351A probably benign Het
Iqub A G 6: 24,500,394 V287A possibly damaging Het
Lix1 A T 17: 17,427,212 T47S probably benign Het
Lrp1b A T 2: 40,663,610 probably null Het
Nup107 G A 10: 117,770,198 T500I probably damaging Het
Phf21b G C 15: 84,791,094 R405G probably benign Het
Piezo2 A G 18: 63,108,030 V709A probably damaging Het
Rfc1 T C 5: 65,311,044 T109A probably damaging Het
Rpa1 A G 11: 75,313,115 V302A probably damaging Het
Ryr2 A G 13: 11,745,631 I1522T probably benign Het
Ryr3 C A 2: 112,763,665 R2578L possibly damaging Het
Scgb2b18 C T 7: 33,173,256 W41* probably null Het
Sdccag8 C G 1: 176,868,290 Q387E possibly damaging Het
Slc25a17 G A 15: 81,329,145 T119M probably damaging Het
Slc45a4 G T 15: 73,605,640 Q16K probably benign Het
Slc4a1 G A 11: 102,361,419 probably benign Het
Slc7a14 T C 3: 31,257,731 T47A probably benign Het
Stard6 A G 18: 70,483,482 R71G probably damaging Het
Tecr A G 8: 83,571,935 V321A probably damaging Het
Ttc3 T A 16: 94,394,359 F290L probably benign Het
Uqcc1 A G 2: 155,911,811 V48A probably benign Het
V1rd19 T A 7: 24,003,883 I258N probably damaging Het
Zar1 T A 5: 72,580,312 E249V possibly damaging Het
Zfp101 T C 17: 33,382,585 T66A possibly damaging Het
Zyx A G 6: 42,351,659 H230R probably benign Het
Other mutations in Fastkd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Fastkd5 APN 2 130616377 missense probably benign 0.14
IGL01148:Fastkd5 APN 2 130614685 missense probably benign
IGL01765:Fastkd5 APN 2 130615734 missense possibly damaging 0.95
IGL01806:Fastkd5 APN 2 130615612 missense probably benign 0.02
IGL02266:Fastkd5 APN 2 130615561 missense probably damaging 1.00
IGL02879:Fastkd5 APN 2 130614421 missense probably damaging 0.97
R0504:Fastkd5 UTSW 2 130615917 missense probably benign 0.08
R0544:Fastkd5 UTSW 2 130615296 missense probably damaging 1.00
R1140:Fastkd5 UTSW 2 130616215 missense probably benign 0.00
R1459:Fastkd5 UTSW 2 130614797 missense probably damaging 0.97
R1770:Fastkd5 UTSW 2 130614280 missense probably damaging 1.00
R2519:Fastkd5 UTSW 2 130616194 missense possibly damaging 0.56
R2566:Fastkd5 UTSW 2 130616365 missense probably benign 0.00
R3080:Fastkd5 UTSW 2 130615453 missense possibly damaging 0.89
R4496:Fastkd5 UTSW 2 130616581 missense probably benign 0.01
R5566:Fastkd5 UTSW 2 130614301 missense possibly damaging 0.88
R6516:Fastkd5 UTSW 2 130614301 missense possibly damaging 0.88
R6993:Fastkd5 UTSW 2 130616539 missense probably benign
R7032:Fastkd5 UTSW 2 130615944 missense possibly damaging 0.92
R7049:Fastkd5 UTSW 2 130615511 missense probably damaging 1.00
R7051:Fastkd5 UTSW 2 130614417 missense probably damaging 1.00
R7348:Fastkd5 UTSW 2 130615135 missense probably damaging 1.00
R7348:Fastkd5 UTSW 2 130616439 missense probably benign 0.00
R7524:Fastkd5 UTSW 2 130616128 missense probably benign 0.41
R7603:Fastkd5 UTSW 2 130615041 missense possibly damaging 0.95
R7657:Fastkd5 UTSW 2 130616256 missense probably benign 0.00
R7745:Fastkd5 UTSW 2 130615068 missense probably damaging 1.00
R7912:Fastkd5 UTSW 2 130616637 missense probably damaging 0.97
R7993:Fastkd5 UTSW 2 130616637 missense probably damaging 0.97
X0018:Fastkd5 UTSW 2 130616612 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CCGCATGACAAATTCAGAGAG -3'
(R):5'- TTAACACCTCCGATCTGATCAG -3'

Sequencing Primer
(F):5'- GACAAATTCAGAGAGACTACTACTTG -3'
(R):5'- CCGATCTGATCAGTATTTTGAAAGCC -3'
Posted On2019-09-13