Incidental Mutation 'R7339:Padi1'
ID 569692
Institutional Source Beutler Lab
Gene Symbol Padi1
Ensembl Gene ENSMUSG00000025329
Gene Name peptidyl arginine deiminase, type I
Synonyms Pad type 1, Pdi1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R7339 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 140812983-140845778 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140829234 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 190 (D190G)
Ref Sequence ENSEMBL: ENSMUSP00000026378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026378]
AlphaFold Q9Z185
Predicted Effect probably null
Transcript: ENSMUST00000026378
AA Change: D190G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026378
Gene: ENSMUSG00000025329
AA Change: D190G

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 5.4e-39 PFAM
Pfam:PAD_M 115 272 1.3e-63 PFAM
Pfam:PAD 280 659 9.4e-170 PFAM
Meta Mutation Damage Score 0.6676 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type I enzyme is involved in the late stages of epidermal differentiation, where it deiminates filaggrin and keratin K1, which maintains hydration of the stratum corneum, and hence the cutaneous barrier function. This enzyme may also play a role in hair follicle formation. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Metap1 T C 3: 138,466,137 probably null Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh6 T C 14: 54,961,568 probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr503 A C 7: 108,544,900 D125A probably damaging Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Padi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Padi1 APN 4 140829435 missense probably damaging 1.00
IGL01972:Padi1 APN 4 140818859 splice site probably benign
IGL03260:Padi1 APN 4 140828194 missense probably benign 0.11
R0598:Padi1 UTSW 4 140814787 missense possibly damaging 0.84
R1164:Padi1 UTSW 4 140832329 missense possibly damaging 0.50
R1793:Padi1 UTSW 4 140814656 missense probably damaging 1.00
R4208:Padi1 UTSW 4 140817227 missense possibly damaging 0.80
R4256:Padi1 UTSW 4 140814778 missense probably damaging 1.00
R4484:Padi1 UTSW 4 140817270 intron probably benign
R4926:Padi1 UTSW 4 140824847 missense probably damaging 0.99
R4967:Padi1 UTSW 4 140845590 missense probably benign 0.00
R5066:Padi1 UTSW 4 140829437 missense probably damaging 1.00
R5523:Padi1 UTSW 4 140814853 missense probably damaging 1.00
R5622:Padi1 UTSW 4 140824955 missense probably damaging 1.00
R5850:Padi1 UTSW 4 140814830 missense probably benign 0.03
R5870:Padi1 UTSW 4 140826581 missense probably benign 0.39
R5951:Padi1 UTSW 4 140814829 missense probably damaging 1.00
R6187:Padi1 UTSW 4 140826965 missense probably damaging 1.00
R7257:Padi1 UTSW 4 140829471 missense probably damaging 1.00
R7326:Padi1 UTSW 4 140832404 missense probably benign 0.15
R8282:Padi1 UTSW 4 140814703 missense probably damaging 1.00
R9083:Padi1 UTSW 4 140832291 critical splice donor site probably null
R9590:Padi1 UTSW 4 140817241 missense probably damaging 1.00
X0024:Padi1 UTSW 4 140828167 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGTTCCCTGATGGAGTAGC -3'
(R):5'- TCCTGTTGGTAAACTGTGACAG -3'

Sequencing Primer
(F):5'- GTAGCCATGCAAGCCACAGTG -3'
(R):5'- CTGTGACAGAGATATCCATGGGTCC -3'
Posted On 2019-09-13