Incidental Mutation 'R7344:Scrib'
ID570114
Institutional Source Beutler Lab
Gene Symbol Scrib
Ensembl Gene ENSMUSG00000022568
Gene Namescribbled planar cell polarity
SynonymsScrb1, Crc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76047158-76069784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76049258 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1332 (Y1332C)
Ref Sequence ENSEMBL: ENSMUSP00000002603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002603] [ENSMUST00000063747] [ENSMUST00000109946] [ENSMUST00000145830] [ENSMUST00000148211] [ENSMUST00000187868]
Predicted Effect probably damaging
Transcript: ENSMUST00000002603
AA Change: Y1332C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002603
Gene: ENSMUSG00000022568
AA Change: Y1332C

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1306 1321 N/A INTRINSIC
coiled coil region 1390 1420 N/A INTRINSIC
low complexity region 1452 1464 N/A INTRINSIC
low complexity region 1498 1515 N/A INTRINSIC
low complexity region 1549 1560 N/A INTRINSIC
low complexity region 1648 1665 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063747
AA Change: Y1304C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068056
Gene: ENSMUSG00000022568
AA Change: Y1304C

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1595 1612 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109946
AA Change: Y1304C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105572
Gene: ENSMUSG00000022568
AA Change: Y1304C

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145830
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115329
Gene: ENSMUSG00000022568
AA Change: Y44C

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148211
AA Change: Y72C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114573
Gene: ENSMUSG00000022568
AA Change: Y72C

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187868
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as being similar to the Drosophila scribble protein. The mammalian protein is involved in tumor suppression pathways. As a scaffold protein involved in cell polarization processes, this protein binds to many other proteins. The encoded protein binds to papillomavirus E6 protein via its PDZ domain and the C-terminus of E6. Two alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele display partial prenatal lethality. Mice homozygous for spontaneous or induced alleles exhibit craniofacial or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Scrib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Scrib APN 15 76048794 missense possibly damaging 0.49
IGL00905:Scrib APN 15 76064990 missense probably damaging 0.96
IGL01529:Scrib APN 15 76049235 missense possibly damaging 0.66
IGL01896:Scrib APN 15 76066118 missense possibly damaging 0.75
IGL01947:Scrib APN 15 76061767 missense probably benign 0.01
IGL02219:Scrib APN 15 76065036 nonsense probably null
IGL02372:Scrib APN 15 76048255 missense probably damaging 0.99
IGL02880:Scrib APN 15 76066124 missense probably damaging 1.00
IGL02959:Scrib APN 15 76065207 missense probably damaging 0.99
R0605:Scrib UTSW 15 76067553 missense possibly damaging 0.89
R0711:Scrib UTSW 15 76066907 unclassified probably benign
R0757:Scrib UTSW 15 76062750 small deletion probably benign
R0903:Scrib UTSW 15 76066855 missense possibly damaging 0.95
R0959:Scrib UTSW 15 76051461 missense probably benign 0.34
R1483:Scrib UTSW 15 76057922 missense probably damaging 1.00
R1551:Scrib UTSW 15 76065162 missense probably damaging 1.00
R1604:Scrib UTSW 15 76048240 missense probably damaging 0.97
R1613:Scrib UTSW 15 76048542 missense probably damaging 1.00
R1615:Scrib UTSW 15 76066205 missense probably benign 0.39
R1681:Scrib UTSW 15 76064567 missense probably damaging 1.00
R3110:Scrib UTSW 15 76069374 missense probably damaging 0.98
R3112:Scrib UTSW 15 76069374 missense probably damaging 0.98
R4050:Scrib UTSW 15 76051473 missense possibly damaging 0.91
R4660:Scrib UTSW 15 76065336 missense probably damaging 0.98
R4976:Scrib UTSW 15 76051753 critical splice donor site probably null
R5119:Scrib UTSW 15 76051753 critical splice donor site probably null
R5243:Scrib UTSW 15 76065252 missense probably benign 0.00
R5246:Scrib UTSW 15 76064797 missense probably benign 0.19
R5483:Scrib UTSW 15 76067659 critical splice donor site probably null
R5516:Scrib UTSW 15 76062863 missense possibly damaging 0.50
R5628:Scrib UTSW 15 76049540 missense possibly damaging 0.66
R5787:Scrib UTSW 15 76059302 missense probably damaging 1.00
R5894:Scrib UTSW 15 76067732 missense probably damaging 0.99
R6005:Scrib UTSW 15 76057751 missense probably damaging 1.00
R6041:Scrib UTSW 15 76067172 missense possibly damaging 0.93
R6351:Scrib UTSW 15 76064986 missense possibly damaging 0.65
R6603:Scrib UTSW 15 76062723 missense probably benign 0.00
R7298:Scrib UTSW 15 76064761 missense probably damaging 1.00
R7428:Scrib UTSW 15 76061198 missense probably damaging 1.00
R7486:Scrib UTSW 15 76057650 missense probably damaging 1.00
R7764:Scrib UTSW 15 76047393 makesense probably null
Z1088:Scrib UTSW 15 76048231 missense probably damaging 0.99
Z1177:Scrib UTSW 15 76057770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAGTACTTTTGTCGTTCACG -3'
(R):5'- TGGAACAGTTGCTTCCAGAG -3'

Sequencing Primer
(F):5'- TCGTTCACGGAAGGACAGCTG -3'
(R):5'- CTTCCAGAGCAGGATGGGG -3'
Posted On2019-09-13