Incidental Mutation 'R7441:Olfr742'
ID576977
Institutional Source Beutler Lab
Gene Symbol Olfr742
Ensembl Gene ENSMUSG00000068431
Gene Nameolfactory receptor 742
SynonymsGA_x6K02T2PMLR-6224293-6225228, MOR106-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7441 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50503600-50517145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50515396 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 64 (Y64F)
Ref Sequence ENSEMBL: ENSMUSP00000150814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089836] [ENSMUST00000213935] [ENSMUST00000217437]
Predicted Effect probably damaging
Transcript: ENSMUST00000089836
AA Change: Y64F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087273
Gene: ENSMUSG00000068431
AA Change: Y64F

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.9e-55 PFAM
Pfam:7tm_1 45 294 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213935
AA Change: Y64F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217437
AA Change: Y64F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bahcc1 T C 11: 120,286,306 S2007P probably damaging Het
Cyfip2 A T 11: 46,196,427 I1212N possibly damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Esr2 C A 12: 76,141,394 M363I probably benign Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp426 T C 9: 20,470,851 E280G possibly damaging Het
Zfp810 C A 9: 22,279,272 E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in Olfr742
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Olfr742 APN 14 50515443 missense probably damaging 0.97
R0046:Olfr742 UTSW 14 50516139 makesense probably null
R0369:Olfr742 UTSW 14 50515825 missense probably benign 0.00
R0612:Olfr742 UTSW 14 50515482 missense probably benign
R1588:Olfr742 UTSW 14 50516127 missense probably benign
R1726:Olfr742 UTSW 14 50516179 utr 3 prime probably null
R1998:Olfr742 UTSW 14 50515356 missense probably benign 0.00
R2875:Olfr742 UTSW 14 50515812 missense probably benign 0.06
R4009:Olfr742 UTSW 14 50515962 missense possibly damaging 0.77
R5119:Olfr742 UTSW 14 50515509 missense probably benign 0.00
R5232:Olfr742 UTSW 14 50516038 missense probably damaging 0.99
R5627:Olfr742 UTSW 14 50515800 missense probably benign
R5930:Olfr742 UTSW 14 50515792 missense probably benign
R6597:Olfr742 UTSW 14 50515551 missense probably benign 0.11
R7596:Olfr742 UTSW 14 50515545 missense probably benign 0.14
R8051:Olfr742 UTSW 14 50515643 missense probably benign 0.00
Z1088:Olfr742 UTSW 14 50515527 missense possibly damaging 0.90
Z1176:Olfr742 UTSW 14 50516065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCTTTCACAGGTCACACAC -3'
(R):5'- GATCAAATGCCATGACTGCCAG -3'

Sequencing Primer
(F):5'- GCTTTCACAGGTCACACACAGATG -3'
(R):5'- CTGCCAGGAAAAAGCATTCTG -3'
Posted On2019-10-07