Incidental Mutation 'R6747:Slc39a8'
ID530571
Institutional Source Beutler Lab
Gene Symbol Slc39a8
Ensembl Gene ENSMUSG00000053897
Gene Namesolute carrier family 39 (metal ion transporter), member 8
Synonyms4933419D20Rik, BIGM103, ZIP8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location135825279-135888572 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 135849180 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029810] [ENSMUST00000081978] [ENSMUST00000167390] [ENSMUST00000180196]
Predicted Effect probably null
Transcript: ENSMUST00000029810
SMART Domains Protein: ENSMUSP00000029810
Gene: ENSMUSG00000053897

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 6.2e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081978
SMART Domains Protein: ENSMUSP00000080640
Gene: ENSMUSG00000053897

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139953
Predicted Effect probably null
Transcript: ENSMUST00000167390
SMART Domains Protein: ENSMUSP00000128245
Gene: ENSMUSG00000053897

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180196
SMART Domains Protein: ENSMUSP00000136634
Gene: ENSMUSG00000053897

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC39 family of solute-carrier genes, which show structural characteristics of zinc transporters. The encoded protein is glycosylated and found in the plasma membrane and mitochondria, and functions in the cellular import of zinc at the onset of inflammation. It is also thought to be the primary transporter of the toxic cation cadmium, which is found in cigarette smoke. Multiple transcript variants encoding different isoforms have been found for this gene. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Cstf3 G T 2: 104,646,767 V168F probably damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Slc39a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Slc39a8 APN 3 135858112 missense probably benign
IGL00793:Slc39a8 APN 3 135884733 missense probably benign 0.00
IGL02591:Slc39a8 APN 3 135884620 missense probably damaging 1.00
IGL02868:Slc39a8 APN 3 135856026 missense probably damaging 1.00
IGL03062:Slc39a8 APN 3 135886797 splice site probably benign
IGL03144:Slc39a8 APN 3 135884210 missense probably benign 0.01
IGL03329:Slc39a8 APN 3 135884713 missense probably damaging 0.98
R1449:Slc39a8 UTSW 3 135826685 missense probably benign 0.41
R2869:Slc39a8 UTSW 3 135886793 splice site probably null
R2869:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2873:Slc39a8 UTSW 3 135886793 splice site probably null
R2937:Slc39a8 UTSW 3 135886823 missense probably benign 0.00
R3832:Slc39a8 UTSW 3 135849133 missense probably damaging 0.96
R4669:Slc39a8 UTSW 3 135856011 missense probably benign 0.35
R5057:Slc39a8 UTSW 3 135849029 missense probably benign 0.00
R5098:Slc39a8 UTSW 3 135858157 missense probably benign 0.01
R5677:Slc39a8 UTSW 3 135884688 missense probably damaging 1.00
R7181:Slc39a8 UTSW 3 135857538 missense possibly damaging 0.93
R7459:Slc39a8 UTSW 3 135886911 missense probably damaging 1.00
R7506:Slc39a8 UTSW 3 135884306 missense probably benign 0.03
R7589:Slc39a8 UTSW 3 135884362 missense probably damaging 0.96
R7860:Slc39a8 UTSW 3 135884396 missense probably damaging 1.00
R7943:Slc39a8 UTSW 3 135884396 missense probably damaging 1.00
X0023:Slc39a8 UTSW 3 135826544 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCATTACTATCTGTGTGCC -3'
(R):5'- TCAGTCTTGATCCCACAAGCAG -3'

Sequencing Primer
(F):5'- ATTACTATCTGTGTGCCTCTGTTTG -3'
(R):5'- GAAGCGCATTGCATACA -3'
Posted On2018-08-01