Incidental Mutation 'R8059:Slc39a8'
ID619585
Institutional Source Beutler Lab
Gene Symbol Slc39a8
Ensembl Gene ENSMUSG00000053897
Gene Namesolute carrier family 39 (metal ion transporter), member 8
Synonyms4933419D20Rik, BIGM103, ZIP8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location135825279-135888572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 135826586 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 39 (A39S)
Ref Sequence ENSEMBL: ENSMUSP00000029810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029810] [ENSMUST00000081978] [ENSMUST00000167390] [ENSMUST00000180196]
Predicted Effect probably benign
Transcript: ENSMUST00000029810
AA Change: A39S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029810
Gene: ENSMUSG00000053897
AA Change: A39S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 6.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081978
AA Change: A39S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080640
Gene: ENSMUSG00000053897
AA Change: A39S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167390
AA Change: A39S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128245
Gene: ENSMUSG00000053897
AA Change: A39S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180196
AA Change: A39S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136634
Gene: ENSMUSG00000053897
AA Change: A39S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC39 family of solute-carrier genes, which show structural characteristics of zinc transporters. The encoded protein is glycosylated and found in the plasma membrane and mitochondria, and functions in the cellular import of zinc at the onset of inflammation. It is also thought to be the primary transporter of the toxic cation cadmium, which is found in cigarette smoke. Multiple transcript variants encoding different isoforms have been found for this gene. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rgs3 T C 4: 62,602,977 probably benign Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Slc39a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Slc39a8 APN 3 135858112 missense probably benign
IGL00793:Slc39a8 APN 3 135884733 missense probably benign 0.00
IGL02591:Slc39a8 APN 3 135884620 missense probably damaging 1.00
IGL02868:Slc39a8 APN 3 135856026 missense probably damaging 1.00
IGL03062:Slc39a8 APN 3 135886797 splice site probably benign
IGL03144:Slc39a8 APN 3 135884210 missense probably benign 0.01
IGL03329:Slc39a8 APN 3 135884713 missense probably damaging 0.98
R1449:Slc39a8 UTSW 3 135826685 missense probably benign 0.41
R2869:Slc39a8 UTSW 3 135886793 splice site probably null
R2869:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2873:Slc39a8 UTSW 3 135886793 splice site probably null
R2937:Slc39a8 UTSW 3 135886823 missense probably benign 0.00
R3832:Slc39a8 UTSW 3 135849133 missense probably damaging 0.96
R4669:Slc39a8 UTSW 3 135856011 missense probably benign 0.35
R5057:Slc39a8 UTSW 3 135849029 missense probably benign 0.00
R5098:Slc39a8 UTSW 3 135858157 missense probably benign 0.01
R5677:Slc39a8 UTSW 3 135884688 missense probably damaging 1.00
R6747:Slc39a8 UTSW 3 135849180 critical splice donor site probably null
R7181:Slc39a8 UTSW 3 135857538 missense possibly damaging 0.93
R7459:Slc39a8 UTSW 3 135886911 missense probably damaging 1.00
R7506:Slc39a8 UTSW 3 135884306 missense probably benign 0.03
R7589:Slc39a8 UTSW 3 135884362 missense probably damaging 0.96
R7860:Slc39a8 UTSW 3 135884396 missense probably damaging 1.00
R8096:Slc39a8 UTSW 3 135884656 missense probably damaging 1.00
R8144:Slc39a8 UTSW 3 135884643 nonsense probably null
R8218:Slc39a8 UTSW 3 135857564 missense probably benign 0.03
X0023:Slc39a8 UTSW 3 135826544 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGGAGTGTCTCGCTAACTG -3'
(R):5'- GAAATCCTTTCTCTGGTGCTACTGC -3'

Sequencing Primer
(F):5'- TGTCTCGCTAACTGGGCCAG -3'
(R):5'- CTACTGCTCTGGGGATGGGAATC -3'
Posted On2020-01-23