Incidental Mutation 'R7586:Trpm7'
ID587124
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Nametransient receptor potential cation channel, subfamily M, member 7
SynonymsLTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7586 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location126791565-126876230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126810165 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1463 (S1463T)
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
PDB Structure
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028843
AA Change: S1463T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: S1463T

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103224
AA Change: S1463T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: S1463T

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,793 N446Y possibly damaging Het
Ankdd1a C T 9: 65,502,184 probably null Het
Ankrd31 A G 13: 96,832,054 E733G possibly damaging Het
Cars2 C T 8: 11,530,321 W239* probably null Het
Catsperz A T 19: 6,922,561 L192* probably null Het
Cdh3 T C 8: 106,511,343 probably null Het
Cfh C T 1: 140,147,721 V260M probably damaging Het
Clcn4 T A 7: 7,293,959 S227C probably benign Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Col27a1 C A 4: 63,225,041 A322D probably damaging Het
Egflam C T 15: 7,208,601 G934S probably damaging Het
Eloa A G 4: 136,007,199 V665A probably damaging Het
Epg5 A G 18: 78,030,060 T2433A probably benign Het
Ercc5 A G 1: 44,175,851 N848S possibly damaging Het
Fbrsl1 A C 5: 110,378,154 F61V probably damaging Het
Fry T C 5: 150,426,218 Y1595H probably damaging Het
Fstl4 A G 11: 53,072,429 N213D probably benign Het
Gab2 C T 7: 97,301,438 P446L probably damaging Het
Ganab A T 19: 8,911,352 Y552F possibly damaging Het
Gfy C T 7: 45,177,538 R378Q probably damaging Het
Gm3285 T C 10: 77,862,041 V8A unknown Het
Gm8251 G A 1: 44,060,013 R642W probably benign Het
Grip1 A T 10: 120,077,138 probably null Het
Gtf3c3 A G 1: 54,403,593 L764P probably damaging Het
Igfbp2 A T 1: 72,849,148 M150L probably benign Het
Jakmip2 C T 18: 43,540,611 R796Q probably damaging Het
Jpt1 T A 11: 115,498,195 R141W probably damaging Het
Junb T C 8: 84,978,173 E86G probably damaging Het
Klhl41 A T 2: 69,674,724 D457V probably benign Het
Lama2 T C 10: 27,101,393 Y1930C probably benign Het
Med13 A T 11: 86,271,002 I2167N probably damaging Het
Msh3 A G 13: 92,349,332 probably benign Het
Myo1b A C 1: 51,778,324 I593S probably damaging Het
Myo1c A T 11: 75,657,519 T16S possibly damaging Het
Ndufaf4 C T 4: 24,901,829 L126F probably damaging Het
Nlrp9a A T 7: 26,557,296 N113I possibly damaging Het
Olfr1000 G C 2: 85,608,184 S242C probably damaging Het
Olfr1173 T A 2: 88,274,450 I200F probably damaging Het
Olfr478 T A 7: 108,031,921 T141S probably benign Het
Pabpc6 A T 17: 9,668,682 D313E probably damaging Het
Pcdhb2 G T 18: 37,295,804 G277* probably null Het
Phkb T G 8: 86,029,597 V840G probably damaging Het
Pip4k2c A G 10: 127,199,086 F415S probably damaging Het
Ptprb A G 10: 116,343,874 E1112G probably damaging Het
Pum2 A G 12: 8,747,206 D847G probably damaging Het
Qrich2 C T 11: 116,455,624 R1458H probably benign Het
Rdh11 T C 12: 79,185,183 Y199C probably damaging Het
Scamp3 A G 3: 89,180,366 Y171C probably damaging Het
Serpinb9b T C 13: 33,039,760 S312P probably damaging Het
Slain2 G A 5: 72,965,822 S461N probably benign Het
Slc23a1 G A 18: 35,625,838 T100I probably damaging Het
Spata31d1b T A 13: 59,718,380 I1114N probably damaging Het
Spinkl A G 18: 44,174,589 S2P probably damaging Het
Srrt T C 5: 137,302,195 N173S probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Supt16 A T 14: 52,173,556 V697E probably damaging Het
Taf6l C T 19: 8,783,846 E53K probably damaging Het
Tmem81 A T 1: 132,507,773 I106F probably damaging Het
Tnxb C A 17: 34,716,408 L2561I probably damaging Het
Top3b G A 16: 16,891,368 R640H probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tubal3 A C 13: 3,928,198 D38A possibly damaging Het
Vps13a T A 19: 16,647,598 I2766F probably benign Het
Wwc1 A T 11: 35,844,195 V951E possibly damaging Het
Zfp777 A T 6: 48,029,218 M414K probably benign Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126829031 missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126846072 critical splice donor site probably null
IGL01634:Trpm7 APN 2 126826818 missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126816799 missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126813184 missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126797943 missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126799243 unclassified probably benign
IGL02172:Trpm7 APN 2 126795328 missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126807362 missense probably benign
IGL02375:Trpm7 APN 2 126825744 missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126819891 missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126840779 missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126846159 missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126807287 critical splice donor site probably null
Accused UTSW 2 126826737 missense probably damaging 0.99
Condemned UTSW 2 126835508 missense probably damaging 1.00
P0037:Trpm7 UTSW 2 126816757 splice site probably benign
R0038:Trpm7 UTSW 2 126795468 missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126812771 missense probably benign
R0165:Trpm7 UTSW 2 126797513 missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126826718 nonsense probably null
R0543:Trpm7 UTSW 2 126848529 missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126846072 critical splice donor site probably null
R0844:Trpm7 UTSW 2 126835508 missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126799239 unclassified probably null
R0919:Trpm7 UTSW 2 126831238 missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126805049 missense probably benign
R1109:Trpm7 UTSW 2 126797793 missense probably benign 0.01
R1118:Trpm7 UTSW 2 126822486 missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126825454 nonsense probably null
R1527:Trpm7 UTSW 2 126830162 missense probably benign 0.18
R1542:Trpm7 UTSW 2 126822599 nonsense probably null
R1882:Trpm7 UTSW 2 126812777 missense probably benign 0.00
R1951:Trpm7 UTSW 2 126831299 missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126823997 nonsense probably null
R2012:Trpm7 UTSW 2 126823997 nonsense probably null
R2026:Trpm7 UTSW 2 126812738 missense probably benign 0.39
R2067:Trpm7 UTSW 2 126797727 missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126858409 splice site probably benign
R3082:Trpm7 UTSW 2 126844422 missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126826710 splice site probably benign
R3607:Trpm7 UTSW 2 126796428 intron probably benign
R3739:Trpm7 UTSW 2 126851521 missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126831218 missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126816831 missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126829163 missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126795509 splice site probably null
R4392:Trpm7 UTSW 2 126848538 missense probably damaging 1.00
R4404:Trpm7 UTSW 2 126833715 missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126797211 missense probably benign 0.01
R4714:Trpm7 UTSW 2 126840783 nonsense probably null
R4807:Trpm7 UTSW 2 126831229 missense probably benign 0.00
R4815:Trpm7 UTSW 2 126858492 missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126813185 missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126824058 missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126796336 critical splice donor site probably null
R5263:Trpm7 UTSW 2 126821217 missense probably benign 0.34
R5361:Trpm7 UTSW 2 126829241 missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126842855 critical splice donor site probably null
R5574:Trpm7 UTSW 2 126813030 missense probably benign
R5782:Trpm7 UTSW 2 126797714 missense probably benign 0.04
R5840:Trpm7 UTSW 2 126822611 nonsense probably null
R6044:Trpm7 UTSW 2 126814745 missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126837381 missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126825639 missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126807294 missense probably benign
R6530:Trpm7 UTSW 2 126812711 missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126844420 missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126813021 missense probably benign 0.00
R6868:Trpm7 UTSW 2 126837414 missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126826765 missense possibly damaging 0.87
R7402:Trpm7 UTSW 2 126799206 missense probably damaging 1.00
R7451:Trpm7 UTSW 2 126826737 missense probably damaging 0.99
R7486:Trpm7 UTSW 2 126831195 critical splice donor site probably null
R7509:Trpm7 UTSW 2 126849922 missense probably damaging 1.00
R7774:Trpm7 UTSW 2 126813238 missense probably benign 0.09
R7793:Trpm7 UTSW 2 126824075 nonsense probably null
R7812:Trpm7 UTSW 2 126799316 missense probably damaging 1.00
R7900:Trpm7 UTSW 2 126797498 missense probably benign 0.01
R7983:Trpm7 UTSW 2 126797498 missense probably benign 0.01
R8034:Trpm7 UTSW 2 126846199 missense probably damaging 0.98
X0026:Trpm7 UTSW 2 126829290 missense probably benign
Z1088:Trpm7 UTSW 2 126797281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGCCAATCATTCCATATACTCA -3'
(R):5'- CAGAGCCTGAAAGTTACTTGAATCA -3'

Sequencing Primer
(F):5'- CAGCCTGGTATACAAAGTGAGTTCC -3'
(R):5'- GATTGTACTTCAGTTAGTAGGAA -3'
Posted On2019-10-24