Incidental Mutation 'R7601:Cdh22'
ID587999
Institutional Source Beutler Lab
Gene Symbol Cdh22
Ensembl Gene ENSMUSG00000053166
Gene Namecadherin 22
SynonymsPB-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R7601 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location165111507-165234853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165112546 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 685 (L685P)
Ref Sequence ENSEMBL: ENSMUSP00000066864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]
Predicted Effect probably damaging
Transcript: ENSMUST00000065438
AA Change: L685P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: L685P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138643
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,849 L16P probably damaging Het
Abcc5 A T 16: 20,375,132 Y746* probably null Het
Abcd4 A G 12: 84,613,945 Y129H possibly damaging Het
Acot10 T C 15: 20,665,629 D342G probably damaging Het
Als2 G T 1: 59,170,002 T1466K probably benign Het
Calcr A T 6: 3,687,603 I465N probably benign Het
Ccndbp1 T C 2: 121,016,146 S309P probably damaging Het
Cenps A G 4: 149,132,315 V39A possibly damaging Het
Dbr1 G T 9: 99,582,602 E145* probably null Het
Dync1i1 T A 6: 5,905,129 V161E probably benign Het
F10 A G 8: 13,050,781 T232A probably benign Het
Faim2 C T 15: 99,500,266 G279D probably damaging Het
Fam102b T A 3: 108,988,312 T151S possibly damaging Het
Fam114a2 T C 11: 57,514,216 K20R possibly damaging Het
Hspa4l T C 3: 40,784,356 probably null Het
Impg2 A T 16: 56,260,031 I733L probably benign Het
Itga11 T C 9: 62,696,926 V32A probably benign Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lum A T 10: 97,568,306 Y21F probably damaging Het
Muc6 A G 7: 141,636,541 S2740P unknown Het
Nav1 A T 1: 135,460,438 D1082E unknown Het
Nmur1 A C 1: 86,388,019 C41W probably damaging Het
Olfr1281 T C 2: 111,329,220 V267A probably benign Het
Olfr195 A G 16: 59,149,234 N128S probably benign Het
Olfr288 G A 15: 98,186,979 H273Y probably damaging Het
Olfr890 T C 9: 38,143,378 V76A probably benign Het
Pdcd11 T C 19: 47,106,369 S531P not run Het
Phtf1 T A 3: 103,993,845 H403Q probably benign Het
Piezo1 C T 8: 122,483,481 probably null Het
Pigh G A 12: 79,085,705 T111I probably damaging Het
Plekhf1 T C 7: 38,221,880 E88G probably damaging Het
Pnliprp1 C T 19: 58,732,094 T134M probably damaging Het
Ptges T A 2: 30,892,797 Y81F probably benign Het
Sema7a T C 9: 57,940,277 S43P probably benign Het
Sephs2 A T 7: 127,272,946 I325K probably damaging Het
Slc45a1 A T 4: 150,629,537 N750K possibly damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tbc1d23 A T 16: 57,181,534 M519K probably benign Het
Trdn A G 10: 33,196,156 E273G probably benign Het
Ubtf G A 11: 102,306,654 S724F unknown Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Other mutations in Cdh22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cdh22 APN 2 165112601 missense possibly damaging 0.54
IGL01868:Cdh22 APN 2 165157358 missense probably damaging 0.99
IGL01932:Cdh22 APN 2 165170808 missense probably benign 0.05
IGL02268:Cdh22 APN 2 165123719 splice site probably benign
IGL02455:Cdh22 APN 2 165142255 missense possibly damaging 0.46
IGL03231:Cdh22 APN 2 165116206 missense probably benign 0.16
IGL03264:Cdh22 APN 2 165116173 missense probably benign 0.21
IGL03014:Cdh22 UTSW 2 165112411 nonsense probably null
R0712:Cdh22 UTSW 2 165170656 missense probably damaging 1.00
R0865:Cdh22 UTSW 2 165181056 missense probably damaging 0.98
R1192:Cdh22 UTSW 2 165135283 missense probably damaging 1.00
R1700:Cdh22 UTSW 2 165170796 missense probably damaging 1.00
R1844:Cdh22 UTSW 2 165143694 missense probably damaging 1.00
R2005:Cdh22 UTSW 2 165180923 missense probably damaging 1.00
R2137:Cdh22 UTSW 2 165116394 splice site probably benign
R2270:Cdh22 UTSW 2 165143847 splice site probably null
R2271:Cdh22 UTSW 2 165143847 splice site probably null
R2272:Cdh22 UTSW 2 165143847 splice site probably null
R4021:Cdh22 UTSW 2 165143673 missense possibly damaging 0.81
R4022:Cdh22 UTSW 2 165157253 missense probably benign 0.14
R4613:Cdh22 UTSW 2 165143656 missense probably benign
R4625:Cdh22 UTSW 2 165112606 missense probably damaging 1.00
R5038:Cdh22 UTSW 2 165142277 missense probably benign 0.16
R5057:Cdh22 UTSW 2 165116143 missense probably damaging 0.98
R5649:Cdh22 UTSW 2 165116280 missense probably damaging 1.00
R6175:Cdh22 UTSW 2 165146630 missense probably damaging 0.98
R6297:Cdh22 UTSW 2 165143644 missense possibly damaging 0.86
R6445:Cdh22 UTSW 2 165170692 missense probably damaging 0.97
R7294:Cdh22 UTSW 2 165142093 missense possibly damaging 0.94
R7310:Cdh22 UTSW 2 165112294 nonsense probably null
R7595:Cdh22 UTSW 2 165112463 missense probably benign 0.00
R8047:Cdh22 UTSW 2 165170767 missense probably damaging 1.00
Z1088:Cdh22 UTSW 2 165112430 missense probably benign 0.01
Z1176:Cdh22 UTSW 2 165116184 missense probably damaging 1.00
Z1177:Cdh22 UTSW 2 165146680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGGCGAAGTCCTGCTC -3'
(R):5'- AATCCTTAGCACCGCTCTG -3'

Sequencing Primer
(F):5'- CTCGAACGCGTAGGTCTGGAAG -3'
(R):5'- CGCTCTGCATCACTGAAGC -3'
Posted On2019-10-24