Incidental Mutation 'R7779:Olfr794'
ID599098
Institutional Source Beutler Lab
Gene Symbol Olfr794
Ensembl Gene ENSMUSG00000044293
Gene Nameolfactory receptor 794
SynonymsGA_x6K02T2PULF-11248702-11249664, MOR114-11
MMRRC Submission
Accession Numbers

Genbank: NM_146378

Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7779 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129567655-129573110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129571311 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 219 (I219F)
Ref Sequence ENSEMBL: ENSMUSP00000145301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059957] [ENSMUST00000204820]
Predicted Effect probably damaging
Transcript: ENSMUST00000059957
AA Change: I219F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049790
Gene: ENSMUSG00000044293
AA Change: I219F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204820
AA Change: I219F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145301
Gene: ENSMUSG00000044293
AA Change: I219F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,225,320 V563E probably damaging Het
Adra1d A G 2: 131,561,885 V95A probably damaging Het
Ak7 A C 12: 105,742,350 I355L probably benign Het
Ank1 G A 8: 23,096,747 probably null Het
Apol7c A T 15: 77,525,746 H333Q probably damaging Het
Arfgef3 T C 10: 18,595,023 M1665V probably damaging Het
Arid5b A G 10: 68,096,776 Y1099H probably damaging Het
Atp8b1 A G 18: 64,541,382 S943P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bco1 A G 8: 117,117,396 Y283C probably damaging Het
Brd4 A T 17: 32,212,936 D652E probably benign Het
Cacna1s G A 1: 136,119,029 A1799T probably damaging Het
Camsap3 A G 8: 3,597,887 Y65C probably damaging Het
Capn1 T C 19: 5,994,086 K535E probably benign Het
Cbl A G 9: 44,159,096 S480P probably benign Het
Cfap99 A C 5: 34,311,664 N294T probably benign Het
Defa24 A C 8: 21,735,339 S82R probably benign Het
Dnaic2 T C 11: 114,754,409 F557L possibly damaging Het
Dnhd1 T A 7: 105,677,915 H690Q probably benign Het
Dock2 A G 11: 34,714,455 V279A probably benign Het
Dst T A 1: 34,194,597 V3462E probably damaging Het
E2f3 T G 13: 29,918,615 H221P probably damaging Het
Eif2b4 A T 5: 31,190,654 I238N probably damaging Het
Eno4 T C 19: 58,968,543 S530P probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Etl4 C T 2: 20,709,477 T129I probably damaging Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Extl1 T C 4: 134,360,597 K449E probably benign Het
F13b T A 1: 139,516,386 V486E probably benign Het
Fbln2 T A 6: 91,233,194 L40Q probably damaging Het
Glp2r C T 11: 67,709,783 W413* probably null Het
Grin2b A T 6: 135,778,794 Y507* probably null Het
H2-M11 G T 17: 36,548,806 L230F probably benign Het
Il1f6 T C 2: 24,216,601 Y66H probably damaging Het
Itpr1 A G 6: 108,523,348 E2634G possibly damaging Het
Itpr3 A T 17: 27,096,063 Y728F probably damaging Het
Jak1 C T 4: 101,160,142 E764K probably benign Het
Jak3 G T 8: 71,687,288 R1045L probably benign Het
Jam2 T C 16: 84,809,383 I95T probably damaging Het
Kdf1 T C 4: 133,528,485 V171A probably damaging Het
Lactbl1 A T 4: 136,630,996 K93* probably null Het
Lcn6 T C 2: 25,680,793 V131A probably benign Het
Lpar5 T A 6: 125,082,244 D309E probably damaging Het
Lrfn4 T C 19: 4,613,687 E273G probably damaging Het
Lta4h C T 10: 93,474,949 T447I probably benign Het
Lyst A G 13: 13,634,543 E266G probably damaging Het
Mab21l1 A T 3: 55,783,375 I128F possibly damaging Het
Mrgprb4 T G 7: 48,199,147 N11T probably benign Het
Mroh6 G A 15: 75,888,656 T23I possibly damaging Het
Myo1f T C 17: 33,578,273 I143T probably benign Het
Myof C T 19: 37,939,390 D1092N probably damaging Het
Ncan G T 8: 70,115,011 D150E probably damaging Het
Olfr1392 T A 11: 49,294,221 L300Q probably damaging Het
Olfr412 T A 11: 74,364,945 I92N probably damaging Het
Pcm1 A G 8: 41,329,024 Y1948C probably damaging Het
Pcsk6 A T 7: 66,025,404 T669S probably benign Het
Pdlim5 A C 3: 142,242,686 N613K probably benign Het
Pdzk1 T A 3: 96,857,273 V291D probably damaging Het
Plbd2 T C 5: 120,487,678 Q408R probably damaging Het
Ppp1r37 C A 7: 19,532,787 A392S possibly damaging Het
Proser2 T A 2: 6,103,067 probably null Het
Psmd12 T C 11: 107,497,579 V406A probably benign Het
Rab3gap2 T C 1: 185,259,444 V709A probably damaging Het
Radil T C 5: 142,487,565 E787G probably benign Het
Rai14 A C 15: 10,593,026 D177E probably damaging Het
Rbms2 G A 10: 128,143,446 T166I probably damaging Het
Rrh C T 3: 129,815,320 C115Y probably benign Het
Slc1a6 C T 10: 78,795,955 T205I probably damaging Het
Sost T C 11: 101,966,849 E42G possibly damaging Het
Spcs3 T A 8: 54,529,770 I46F possibly damaging Het
Spg11 A G 2: 122,070,939 S1507P probably damaging Het
Sprtn C T 8: 124,898,243 P29L possibly damaging Het
Sptan1 C T 2: 30,021,307 T1886I probably damaging Het
Strn4 T C 7: 16,831,492 F394S probably damaging Het
Syt14 A T 1: 192,984,443 M51K unknown Het
Terb2 A G 2: 122,186,494 K32R probably benign Het
Tex15 G A 8: 33,575,281 G1580R probably damaging Het
Thumpd3 T C 6: 113,059,989 V283A probably damaging Het
Tm7sf2 T C 19: 6,062,917 Y418C possibly damaging Het
Trim24 T G 6: 37,919,397 F263C probably damaging Het
Trim24 T A 6: 37,919,398 F263L probably damaging Het
Trip11 A G 12: 101,883,537 S1423P probably damaging Het
Vps13c G A 9: 67,881,422 V326M probably damaging Het
Vps37c T C 19: 10,712,624 V150A probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc9 A G 2: 164,650,596 V37A probably damaging Het
Yif1b T A 7: 29,245,903 M227K probably damaging Het
Zbtb18 T C 1: 177,446,939 probably benign Het
Zfp318 A G 17: 46,399,894 T848A probably benign Het
Zfp808 T A 13: 62,172,757 I600K possibly damaging Het
Zmym1 C A 4: 127,054,245 S111I probably benign Het
Zmym2 A G 14: 56,928,283 T688A probably damaging Het
Other mutations in Olfr794
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Olfr794 APN 10 129570827 missense possibly damaging 0.95
IGL02157:Olfr794 APN 10 129571150 missense probably damaging 1.00
IGL02804:Olfr794 APN 10 129571437 missense possibly damaging 0.60
IGL02833:Olfr794 APN 10 129570750 missense probably benign 0.26
IGL02930:Olfr794 APN 10 129571315 missense probably damaging 1.00
IGL03038:Olfr794 APN 10 129570921 missense probably benign 0.07
G4846:Olfr794 UTSW 10 129571170 missense probably damaging 1.00
R1539:Olfr794 UTSW 10 129570771 missense probably damaging 0.99
R1737:Olfr794 UTSW 10 129570828 missense probably damaging 1.00
R1845:Olfr794 UTSW 10 129571348 missense probably damaging 1.00
R2198:Olfr794 UTSW 10 129571046 nonsense probably null
R3086:Olfr794 UTSW 10 129571407 missense probably damaging 1.00
R4960:Olfr794 UTSW 10 129571026 missense probably damaging 1.00
R5938:Olfr794 UTSW 10 129571527 missense probably damaging 1.00
R6326:Olfr794 UTSW 10 129570702 missense possibly damaging 0.74
R6598:Olfr794 UTSW 10 129571369 missense probably damaging 1.00
R7034:Olfr794 UTSW 10 129571072 missense possibly damaging 0.91
R7066:Olfr794 UTSW 10 129571504 missense probably damaging 1.00
R7226:Olfr794 UTSW 10 129570715 missense probably benign 0.01
R7324:Olfr794 UTSW 10 129570849 missense probably damaging 1.00
R7408:Olfr794 UTSW 10 129570624 start gained probably benign
Z1176:Olfr794 UTSW 10 129571236 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGTTTGTGCCATCCTTGTCC -3'
(R):5'- GGCAACAGATGTATTGAGCATAGATAC -3'

Sequencing Primer
(F):5'- TGGCATGATCCTACAGCTGGAATTC -3'
(R):5'- AGCTGCCATACATGATGG -3'
Posted On2019-11-26