Incidental Mutation 'R7779:Vps13c'
ID599091
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7779 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67881422 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 326 (V326M)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879] [ENSMUST00000217386]
Predicted Effect probably damaging
Transcript: ENSMUST00000077879
AA Change: V326M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: V326M

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217386
AA Change: V326M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,225,320 V563E probably damaging Het
Adra1d A G 2: 131,561,885 V95A probably damaging Het
Ak7 A C 12: 105,742,350 I355L probably benign Het
Ank1 G A 8: 23,096,747 probably null Het
Apol7c A T 15: 77,525,746 H333Q probably damaging Het
Arfgef3 T C 10: 18,595,023 M1665V probably damaging Het
Arid5b A G 10: 68,096,776 Y1099H probably damaging Het
Atp8b1 A G 18: 64,541,382 S943P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bco1 A G 8: 117,117,396 Y283C probably damaging Het
Brd4 A T 17: 32,212,936 D652E probably benign Het
Cacna1s G A 1: 136,119,029 A1799T probably damaging Het
Camsap3 A G 8: 3,597,887 Y65C probably damaging Het
Capn1 T C 19: 5,994,086 K535E probably benign Het
Cbl A G 9: 44,159,096 S480P probably benign Het
Cfap99 A C 5: 34,311,664 N294T probably benign Het
Defa24 A C 8: 21,735,339 S82R probably benign Het
Dnaic2 T C 11: 114,754,409 F557L possibly damaging Het
Dnhd1 T A 7: 105,677,915 H690Q probably benign Het
Dock2 A G 11: 34,714,455 V279A probably benign Het
Dst T A 1: 34,194,597 V3462E probably damaging Het
E2f3 T G 13: 29,918,615 H221P probably damaging Het
Eif2b4 A T 5: 31,190,654 I238N probably damaging Het
Eno4 T C 19: 58,968,543 S530P probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Etl4 C T 2: 20,709,477 T129I probably damaging Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Extl1 T C 4: 134,360,597 K449E probably benign Het
F13b T A 1: 139,516,386 V486E probably benign Het
Fbln2 T A 6: 91,233,194 L40Q probably damaging Het
Glp2r C T 11: 67,709,783 W413* probably null Het
Grin2b A T 6: 135,778,794 Y507* probably null Het
H2-M11 G T 17: 36,548,806 L230F probably benign Het
Il1f6 T C 2: 24,216,601 Y66H probably damaging Het
Itpr1 A G 6: 108,523,348 E2634G possibly damaging Het
Itpr3 A T 17: 27,096,063 Y728F probably damaging Het
Jak1 C T 4: 101,160,142 E764K probably benign Het
Jak3 G T 8: 71,687,288 R1045L probably benign Het
Jam2 T C 16: 84,809,383 I95T probably damaging Het
Kdf1 T C 4: 133,528,485 V171A probably damaging Het
Lactbl1 A T 4: 136,630,996 K93* probably null Het
Lcn6 T C 2: 25,680,793 V131A probably benign Het
Lpar5 T A 6: 125,082,244 D309E probably damaging Het
Lrfn4 T C 19: 4,613,687 E273G probably damaging Het
Lta4h C T 10: 93,474,949 T447I probably benign Het
Lyst A G 13: 13,634,543 E266G probably damaging Het
Mab21l1 A T 3: 55,783,375 I128F possibly damaging Het
Mrgprb4 T G 7: 48,199,147 N11T probably benign Het
Mroh6 G A 15: 75,888,656 T23I possibly damaging Het
Myo1f T C 17: 33,578,273 I143T probably benign Het
Myof C T 19: 37,939,390 D1092N probably damaging Het
Ncan G T 8: 70,115,011 D150E probably damaging Het
Olfr1392 T A 11: 49,294,221 L300Q probably damaging Het
Olfr412 T A 11: 74,364,945 I92N probably damaging Het
Olfr794 A T 10: 129,571,311 I219F probably damaging Het
Pcm1 A G 8: 41,329,024 Y1948C probably damaging Het
Pcsk6 A T 7: 66,025,404 T669S probably benign Het
Pdlim5 A C 3: 142,242,686 N613K probably benign Het
Pdzk1 T A 3: 96,857,273 V291D probably damaging Het
Plbd2 T C 5: 120,487,678 Q408R probably damaging Het
Ppp1r37 C A 7: 19,532,787 A392S possibly damaging Het
Proser2 T A 2: 6,103,067 probably null Het
Psmd12 T C 11: 107,497,579 V406A probably benign Het
Rab3gap2 T C 1: 185,259,444 V709A probably damaging Het
Radil T C 5: 142,487,565 E787G probably benign Het
Rai14 A C 15: 10,593,026 D177E probably damaging Het
Rbms2 G A 10: 128,143,446 T166I probably damaging Het
Rrh C T 3: 129,815,320 C115Y probably benign Het
Slc1a6 C T 10: 78,795,955 T205I probably damaging Het
Sost T C 11: 101,966,849 E42G possibly damaging Het
Spcs3 T A 8: 54,529,770 I46F possibly damaging Het
Spg11 A G 2: 122,070,939 S1507P probably damaging Het
Sprtn C T 8: 124,898,243 P29L possibly damaging Het
Sptan1 C T 2: 30,021,307 T1886I probably damaging Het
Strn4 T C 7: 16,831,492 F394S probably damaging Het
Syt14 A T 1: 192,984,443 M51K unknown Het
Terb2 A G 2: 122,186,494 K32R probably benign Het
Tex15 G A 8: 33,575,281 G1580R probably damaging Het
Thumpd3 T C 6: 113,059,989 V283A probably damaging Het
Tm7sf2 T C 19: 6,062,917 Y418C possibly damaging Het
Trim24 T G 6: 37,919,397 F263C probably damaging Het
Trim24 T A 6: 37,919,398 F263L probably damaging Het
Trip11 A G 12: 101,883,537 S1423P probably damaging Het
Vps37c T C 19: 10,712,624 V150A probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc9 A G 2: 164,650,596 V37A probably damaging Het
Yif1b T A 7: 29,245,903 M227K probably damaging Het
Zbtb18 T C 1: 177,446,939 probably benign Het
Zfp318 A G 17: 46,399,894 T848A probably benign Het
Zfp808 T A 13: 62,172,757 I600K possibly damaging Het
Zmym1 C A 4: 127,054,245 S111I probably benign Het
Zmym2 A G 14: 56,928,283 T688A probably damaging Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 splice site probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 splice site probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
R7732:Vps13c UTSW 9 67940516 missense probably damaging 0.97
R7748:Vps13c UTSW 9 67963089 missense probably benign 0.03
R7788:Vps13c UTSW 9 67940483 missense probably benign 0.01
R7894:Vps13c UTSW 9 67926983 missense probably damaging 0.99
R8163:Vps13c UTSW 9 67950438 missense probably benign 0.08
R8165:Vps13c UTSW 9 67858790 missense probably benign 0.00
R8202:Vps13c UTSW 9 67944046 missense probably damaging 0.98
R8235:Vps13c UTSW 9 67927396 missense probably damaging 1.00
R8235:Vps13c UTSW 9 67955781 missense probably benign 0.01
R8253:Vps13c UTSW 9 67943488 nonsense probably null
R8261:Vps13c UTSW 9 67954980 missense probably damaging 1.00
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGCATATTTCTTGTTAGTGATT -3'
(R):5'- GGGAATAACATCATTCAGTACAGTTTA -3'

Sequencing Primer
(F):5'- CACATGATGCCAGTTTTCC -3'
(R):5'- CTGATTACACCAGAGCTG -3'
Posted On2019-11-26