Incidental Mutation 'R7779:Capn1'
ID599126
Institutional Source Beutler Lab
Gene Symbol Capn1
Ensembl Gene ENSMUSG00000024942
Gene Namecalpain 1
Synonymsmu-calpin, Capa1, Capa-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7779 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5988546-6015825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5994086 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 535 (K535E)
Ref Sequence ENSEMBL: ENSMUSP00000025891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000164843]
Predicted Effect probably benign
Transcript: ENSMUST00000025891
AA Change: K535E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942
AA Change: K535E

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164843
AA Change: K535E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942
AA Change: K535E

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a mutation of this gene exhibit decreased platelet aggregation and defective clot retraction although bleeding times remain similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,225,320 V563E probably damaging Het
Adra1d A G 2: 131,561,885 V95A probably damaging Het
Ak7 A C 12: 105,742,350 I355L probably benign Het
Ank1 G A 8: 23,096,747 probably null Het
Apol7c A T 15: 77,525,746 H333Q probably damaging Het
Arfgef3 T C 10: 18,595,023 M1665V probably damaging Het
Arid5b A G 10: 68,096,776 Y1099H probably damaging Het
Atp8b1 A G 18: 64,541,382 S943P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bco1 A G 8: 117,117,396 Y283C probably damaging Het
Brd4 A T 17: 32,212,936 D652E probably benign Het
Cacna1s G A 1: 136,119,029 A1799T probably damaging Het
Camsap3 A G 8: 3,597,887 Y65C probably damaging Het
Cbl A G 9: 44,159,096 S480P probably benign Het
Cfap99 A C 5: 34,311,664 N294T probably benign Het
Defa24 A C 8: 21,735,339 S82R probably benign Het
Dnaic2 T C 11: 114,754,409 F557L possibly damaging Het
Dnhd1 T A 7: 105,677,915 H690Q probably benign Het
Dock2 A G 11: 34,714,455 V279A probably benign Het
Dst T A 1: 34,194,597 V3462E probably damaging Het
E2f3 T G 13: 29,918,615 H221P probably damaging Het
Eif2b4 A T 5: 31,190,654 I238N probably damaging Het
Eno4 T C 19: 58,968,543 S530P probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Etl4 C T 2: 20,709,477 T129I probably damaging Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Extl1 T C 4: 134,360,597 K449E probably benign Het
F13b T A 1: 139,516,386 V486E probably benign Het
Fbln2 T A 6: 91,233,194 L40Q probably damaging Het
Glp2r C T 11: 67,709,783 W413* probably null Het
Grin2b A T 6: 135,778,794 Y507* probably null Het
H2-M11 G T 17: 36,548,806 L230F probably benign Het
Il1f6 T C 2: 24,216,601 Y66H probably damaging Het
Itpr1 A G 6: 108,523,348 E2634G possibly damaging Het
Itpr3 A T 17: 27,096,063 Y728F probably damaging Het
Jak1 C T 4: 101,160,142 E764K probably benign Het
Jak3 G T 8: 71,687,288 R1045L probably benign Het
Jam2 T C 16: 84,809,383 I95T probably damaging Het
Kdf1 T C 4: 133,528,485 V171A probably damaging Het
Lactbl1 A T 4: 136,630,996 K93* probably null Het
Lcn6 T C 2: 25,680,793 V131A probably benign Het
Lpar5 T A 6: 125,082,244 D309E probably damaging Het
Lrfn4 T C 19: 4,613,687 E273G probably damaging Het
Lta4h C T 10: 93,474,949 T447I probably benign Het
Lyst A G 13: 13,634,543 E266G probably damaging Het
Mab21l1 A T 3: 55,783,375 I128F possibly damaging Het
Mrgprb4 T G 7: 48,199,147 N11T probably benign Het
Mroh6 G A 15: 75,888,656 T23I possibly damaging Het
Myo1f T C 17: 33,578,273 I143T probably benign Het
Myof C T 19: 37,939,390 D1092N probably damaging Het
Ncan G T 8: 70,115,011 D150E probably damaging Het
Olfr1392 T A 11: 49,294,221 L300Q probably damaging Het
Olfr412 T A 11: 74,364,945 I92N probably damaging Het
Olfr794 A T 10: 129,571,311 I219F probably damaging Het
Pcm1 A G 8: 41,329,024 Y1948C probably damaging Het
Pcsk6 A T 7: 66,025,404 T669S probably benign Het
Pdlim5 A C 3: 142,242,686 N613K probably benign Het
Pdzk1 T A 3: 96,857,273 V291D probably damaging Het
Plbd2 T C 5: 120,487,678 Q408R probably damaging Het
Ppp1r37 C A 7: 19,532,787 A392S possibly damaging Het
Proser2 T A 2: 6,103,067 probably null Het
Psmd12 T C 11: 107,497,579 V406A probably benign Het
Rab3gap2 T C 1: 185,259,444 V709A probably damaging Het
Radil T C 5: 142,487,565 E787G probably benign Het
Rai14 A C 15: 10,593,026 D177E probably damaging Het
Rbms2 G A 10: 128,143,446 T166I probably damaging Het
Rrh C T 3: 129,815,320 C115Y probably benign Het
Slc1a6 C T 10: 78,795,955 T205I probably damaging Het
Sost T C 11: 101,966,849 E42G possibly damaging Het
Spcs3 T A 8: 54,529,770 I46F possibly damaging Het
Spg11 A G 2: 122,070,939 S1507P probably damaging Het
Sprtn C T 8: 124,898,243 P29L possibly damaging Het
Sptan1 C T 2: 30,021,307 T1886I probably damaging Het
Strn4 T C 7: 16,831,492 F394S probably damaging Het
Syt14 A T 1: 192,984,443 M51K unknown Het
Terb2 A G 2: 122,186,494 K32R probably benign Het
Tex15 G A 8: 33,575,281 G1580R probably damaging Het
Thumpd3 T C 6: 113,059,989 V283A probably damaging Het
Tm7sf2 T C 19: 6,062,917 Y418C possibly damaging Het
Trim24 T G 6: 37,919,397 F263C probably damaging Het
Trim24 T A 6: 37,919,398 F263L probably damaging Het
Trip11 A G 12: 101,883,537 S1423P probably damaging Het
Vps13c G A 9: 67,881,422 V326M probably damaging Het
Vps37c T C 19: 10,712,624 V150A probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc9 A G 2: 164,650,596 V37A probably damaging Het
Yif1b T A 7: 29,245,903 M227K probably damaging Het
Zbtb18 T C 1: 177,446,939 probably benign Het
Zfp318 A G 17: 46,399,894 T848A probably benign Het
Zfp808 T A 13: 62,172,757 I600K possibly damaging Het
Zmym1 C A 4: 127,054,245 S111I probably benign Het
Zmym2 A G 14: 56,928,283 T688A probably damaging Het
Other mutations in Capn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Capn1 APN 19 6007269 missense probably damaging 1.00
IGL01314:Capn1 APN 19 5989984 splice site probably benign
R0044:Capn1 UTSW 19 6014343 missense probably benign 0.03
R1496:Capn1 UTSW 19 6007498 critical splice donor site probably null
R1646:Capn1 UTSW 19 5997730 missense probably benign
R1852:Capn1 UTSW 19 6009103 missense possibly damaging 0.95
R1924:Capn1 UTSW 19 5990056 splice site probably null
R2006:Capn1 UTSW 19 5991583 missense probably damaging 1.00
R2109:Capn1 UTSW 19 6014358 missense probably benign 0.01
R3704:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3705:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3830:Capn1 UTSW 19 5994847 missense probably damaging 1.00
R4664:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4665:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4666:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4694:Capn1 UTSW 19 5994731 nonsense probably null
R4745:Capn1 UTSW 19 5993916 missense probably benign 0.12
R5103:Capn1 UTSW 19 6009110 missense probably damaging 1.00
R5149:Capn1 UTSW 19 5990334 splice site probably null
R5569:Capn1 UTSW 19 6013660 missense probably benign
R5636:Capn1 UTSW 19 6014442 missense probably benign 0.22
R5906:Capn1 UTSW 19 6011421 missense possibly damaging 0.90
R5907:Capn1 UTSW 19 5997797 missense probably benign
R7038:Capn1 UTSW 19 6014319 missense probably benign 0.23
R7091:Capn1 UTSW 19 5991556 missense possibly damaging 0.64
R7307:Capn1 UTSW 19 5993908 missense possibly damaging 0.91
R7592:Capn1 UTSW 19 6014439 missense probably benign 0.00
Z1176:Capn1 UTSW 19 6014278 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAAGATGGTCTGTAGCTCC -3'
(R):5'- ACGCTGGACTGACTTGTACC -3'

Sequencing Primer
(F):5'- CAAGATGGTCTGTAGCTCCTTGAC -3'
(R):5'- GGACTGACTTGTACCCAGCATTTTAG -3'
Posted On2019-11-26