Incidental Mutation 'R4479:Zkscan5'
ID 331391
Institutional Source Beutler Lab
Gene Symbol Zkscan5
Ensembl Gene ENSMUSG00000055991
Gene Name zinc finger with KRAB and SCAN domains 5
Synonyms Zfp95, hKraba1
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock # R4479 (G1)
Quality Score 161
Status Validated
Chromosome 5
Chromosomal Location 145204562-145221750 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 145211174 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031601] [ENSMUST00000085671] [ENSMUST00000161896]
AlphaFold Q9Z1D8
Predicted Effect probably benign
Transcript: ENSMUST00000031601
SMART Domains Protein: ENSMUSP00000031601
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 9.73e-4 SMART
ZnF_C2H2 324 346 1.45e-2 SMART
ZnF_C2H2 352 374 1.28e-3 SMART
ZnF_C2H2 467 489 1.82e-3 SMART
ZnF_C2H2 495 517 3.63e-3 SMART
ZnF_C2H2 523 545 7.78e-3 SMART
ZnF_C2H2 551 573 9.73e-4 SMART
ZnF_C2H2 579 601 1.08e-1 SMART
ZnF_C2H2 635 657 1.12e-3 SMART
ZnF_C2H2 691 713 5.14e-3 SMART
ZnF_C2H2 719 741 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085671
SMART Domains Protein: ENSMUSP00000082814
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
KRAB 216 276 5.35e-3 SMART
ZnF_C2H2 341 363 3.58e-2 SMART
ZnF_C2H2 369 391 9.73e-4 SMART
ZnF_C2H2 397 419 1.45e-2 SMART
ZnF_C2H2 425 447 1.28e-3 SMART
ZnF_C2H2 540 562 1.82e-3 SMART
ZnF_C2H2 568 590 3.63e-3 SMART
ZnF_C2H2 596 618 7.78e-3 SMART
ZnF_C2H2 624 646 9.73e-4 SMART
ZnF_C2H2 652 674 1.08e-1 SMART
ZnF_C2H2 708 730 1.12e-3 SMART
ZnF_C2H2 764 786 5.14e-3 SMART
ZnF_C2H2 792 814 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160162
Predicted Effect probably benign
Transcript: ENSMUST00000161881
SMART Domains Protein: ENSMUSP00000124544
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
KRAB 59 118 2.71e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161896
SMART Domains Protein: ENSMUSP00000124838
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
SCAN 46 155 1.59e-62 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162168
AA Change: V41A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein of the Kruppel family. The protein contains a SCAN box and a KRAB A domain and may be involved in transcriptional regulation. A similar protein in mouse is differentially expressed in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Slc7a11 T C 3: 50,417,963 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Other mutations in Zkscan5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Zkscan5 APN 5 145218650 missense probably damaging 0.99
R0401:Zkscan5 UTSW 5 145212575 missense probably damaging 0.99
R0458:Zkscan5 UTSW 5 145205471 missense probably damaging 0.97
R1456:Zkscan5 UTSW 5 145220988 missense probably benign 0.03
R1801:Zkscan5 UTSW 5 145220205 missense probably damaging 1.00
R2269:Zkscan5 UTSW 5 145205467 missense probably damaging 1.00
R2426:Zkscan5 UTSW 5 145220940 missense probably benign
R3085:Zkscan5 UTSW 5 145221079 missense probably damaging 1.00
R3153:Zkscan5 UTSW 5 145212627 missense probably benign
R3725:Zkscan5 UTSW 5 145220913 missense probably damaging 0.98
R4647:Zkscan5 UTSW 5 145218830 missense possibly damaging 0.71
R5292:Zkscan5 UTSW 5 145218641 missense probably damaging 1.00
R5872:Zkscan5 UTSW 5 145220088 missense probably benign
R5873:Zkscan5 UTSW 5 145220394 missense possibly damaging 0.71
R5916:Zkscan5 UTSW 5 145205302 missense possibly damaging 0.90
R6692:Zkscan5 UTSW 5 145221084 splice site probably null
R7092:Zkscan5 UTSW 5 145220089 missense probably benign
R7114:Zkscan5 UTSW 5 145211178 intron probably benign
R7403:Zkscan5 UTSW 5 145218593 missense probably benign 0.31
R7719:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7741:Zkscan5 UTSW 5 145221037 missense possibly damaging 0.51
R7751:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7829:Zkscan5 UTSW 5 145218703 nonsense probably null
R7874:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7875:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7876:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7879:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7884:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7899:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7902:Zkscan5 UTSW 5 145220866 missense probably damaging 1.00
R7974:Zkscan5 UTSW 5 145207692 missense unknown
R8729:Zkscan5 UTSW 5 145220261 missense probably benign 0.01
R8778:Zkscan5 UTSW 5 145218332 missense probably benign 0.12
R9569:Zkscan5 UTSW 5 145207609 missense not run
Predicted Primers PCR Primer
(F):5'- CATGTGATAAGCGTCATTCTAGTTG -3'
(R):5'- GTCAAGCTAATCCCTCCTGG -3'

Sequencing Primer
(F):5'- AAGTAGGCCTTGAACTCACTG -3'
(R):5'- CACTCAACTGTGCTTAGGGGAAAC -3'
Posted On 2015-07-21