Incidental Mutation 'R8041:Kcnt2'
ID618499
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Namepotassium channel, subfamily T, member 2
SynonymsE330038N15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location140246158-140612067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140609660 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1119 (N1119S)
Ref Sequence ENSEMBL: ENSMUSP00000113333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
Predicted Effect probably benign
Transcript: ENSMUST00000119786
AA Change: N1052S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: N1052S

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120709
AA Change: N1095S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: N1095S

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120796
AA Change: N1119S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: N1119S

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140523098 missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140596051 missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140523211 missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140354555 critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140570417 missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140595998 missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140376383 missense probably benign
IGL02350:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140354561 splice site probably benign
IGL02483:Kcnt2 APN 1 140354561 splice site probably benign
IGL02866:Kcnt2 APN 1 140425248 missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140574806 missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140354507 missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140570455 missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140534002 intron probably benign
R0230:Kcnt2 UTSW 1 140246345 missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140351225 missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140509480 nonsense probably null
R0543:Kcnt2 UTSW 1 140609614 missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140507762 missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140573608 missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140428855 missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140383028 missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140484232 nonsense probably null
R1546:Kcnt2 UTSW 1 140431378 missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140425330 missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140584247 missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140584293 missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140425341 missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140553018 missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140375154 missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140552963 missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140428813 missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140509441 missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140530800 missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140573683 splice site probably null
R2442:Kcnt2 UTSW 1 140376353 missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140428884 missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140533968 missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140584287 missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140609630 missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140425332 missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140552980 missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140507747 missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140523148 missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140518897 missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140354516 missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140513025 nonsense probably null
R4973:Kcnt2 UTSW 1 140609650 missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140351256 missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140609615 missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140426901 missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140574743 missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140509496 missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140425366 missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140533928 missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140507702 missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140362980 missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140426923 nonsense probably null
R6248:Kcnt2 UTSW 1 140509478 missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140375112 missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140509584 missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140584106 missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140351227 missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140246193 unclassified probably benign
R6856:Kcnt2 UTSW 1 140596004 missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140584065 missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140512908 missense probably benign 0.01
R7052:Kcnt2 UTSW 1 140383047 missense probably damaging 0.99
R7138:Kcnt2 UTSW 1 140596040 missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140354517 missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140570478 missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140584055 missense probably damaging 0.99
R7541:Kcnt2 UTSW 1 140376384 missense probably benign 0.09
R7558:Kcnt2 UTSW 1 140523190 missense probably damaging 0.98
R7651:Kcnt2 UTSW 1 140570461 missense probably benign 0.40
R7730:Kcnt2 UTSW 1 140518948 missense probably benign 0.34
R7875:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7883:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R7958:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7966:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R8040:Kcnt2 UTSW 1 140450217 missense probably damaging 1.00
X0062:Kcnt2 UTSW 1 140512991 missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140573646 missense probably damaging 1.00
Z1088:Kcnt2 UTSW 1 140584158 nonsense probably null
Z1176:Kcnt2 UTSW 1 140376361 missense probably damaging 1.00
Z1177:Kcnt2 UTSW 1 140609648 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TTGCCTCAACACTGCGGT -3'
(R):5'- TTAGCCAGGAAAATGTCAACAAATATC -3'

Sequencing Primer
(F):5'- ACCTCATTAGCGTGGAGAACTCTG -3'
(R):5'- AGTCAGGCTCTTAGGACT -3'
Posted On2020-01-23