Incidental Mutation 'R8041:Pcdhb19'
ID618554
Institutional Source Beutler Lab
Gene Symbol Pcdhb19
Ensembl Gene ENSMUSG00000043313
Gene Nameprotocadherin beta 19
SynonymsPcdhbS, Pcdhb11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37496991-37504128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37497314 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 54 (L54P)
Ref Sequence ENSEMBL: ENSMUSP00000053326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055949] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000055949
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000059571
AA Change: L54P

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313
AA Change: L54P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Pcdhb19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Pcdhb19 APN 18 37497989 missense probably damaging 1.00
IGL02070:Pcdhb19 APN 18 37498544 missense probably damaging 1.00
IGL02348:Pcdhb19 APN 18 37498808 missense probably damaging 1.00
IGL02866:Pcdhb19 APN 18 37499110 missense possibly damaging 0.91
IGL02869:Pcdhb19 APN 18 37498637 missense probably damaging 0.98
IGL03118:Pcdhb19 APN 18 37499565 intron probably benign
IGL03120:Pcdhb19 APN 18 37498156 missense probably benign 0.09
IGL03135:Pcdhb19 APN 18 37498535 missense probably benign 0.37
IGL03366:Pcdhb19 APN 18 37498612 missense possibly damaging 0.95
R0147:Pcdhb19 UTSW 18 37497182 missense probably benign 0.01
R0148:Pcdhb19 UTSW 18 37497182 missense probably benign 0.01
R0432:Pcdhb19 UTSW 18 37499535 missense probably benign 0.01
R0609:Pcdhb19 UTSW 18 37497952 missense probably benign
R1438:Pcdhb19 UTSW 18 37497962 missense probably damaging 1.00
R2255:Pcdhb19 UTSW 18 37497944 missense probably benign 0.00
R2265:Pcdhb19 UTSW 18 37497683 missense probably damaging 0.99
R3500:Pcdhb19 UTSW 18 37497479 nonsense probably null
R3708:Pcdhb19 UTSW 18 37497389 missense probably benign 0.04
R4165:Pcdhb19 UTSW 18 37499190 missense probably benign
R4166:Pcdhb19 UTSW 18 37499190 missense probably benign
R4863:Pcdhb19 UTSW 18 37499108 missense probably benign 0.00
R5217:Pcdhb19 UTSW 18 37497886 missense probably benign 0.00
R5770:Pcdhb19 UTSW 18 37498037 missense possibly damaging 0.73
R6031:Pcdhb19 UTSW 18 37497723 missense probably damaging 1.00
R6031:Pcdhb19 UTSW 18 37497723 missense probably damaging 1.00
R6372:Pcdhb19 UTSW 18 37497366 missense probably benign 0.04
R6454:Pcdhb19 UTSW 18 37499269 missense probably benign 0.43
R6985:Pcdhb19 UTSW 18 37497158 missense probably benign 0.00
R7658:Pcdhb19 UTSW 18 37498981 missense probably damaging 0.99
R7662:Pcdhb19 UTSW 18 37498735 missense probably damaging 0.98
R7910:Pcdhb19 UTSW 18 37497667 missense probably benign 0.43
R8318:Pcdhb19 UTSW 18 37497946 missense possibly damaging 0.86
X0062:Pcdhb19 UTSW 18 37497175 missense probably benign
Z1177:Pcdhb19 UTSW 18 37498445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCTTCTGGAAAGCAAC -3'
(R):5'- TTTACATCCGTGACCTGAAGCTC -3'

Sequencing Primer
(F):5'- GCCTTCTGGAAAGCAACTATGG -3'
(R):5'- CTCAGCTTGCAAAATCTTTAAGGGG -3'
Posted On2020-01-23