Incidental Mutation 'R8041:Shc1'
ID618508
Institutional Source Beutler Lab
Gene Symbol Shc1
Ensembl Gene ENSMUSG00000042626
Gene Namesrc homology 2 domain-containing transforming protein C1
SynonymsShcA, p66shc, p66
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89418443-89430027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89422953 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 175 (S175P)
Ref Sequence ENSEMBL: ENSMUSP00000091940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029679] [ENSMUST00000039110] [ENSMUST00000094378] [ENSMUST00000107417] [ENSMUST00000107422] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000137793] [ENSMUST00000154791] [ENSMUST00000183484] [ENSMUST00000191485]
Predicted Effect probably benign
Transcript: ENSMUST00000029679
SMART Domains Protein: ENSMUSP00000029679
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
CKS 5 74 4.1e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039110
AA Change: S65P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626
AA Change: S65P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094378
AA Change: S175P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626
AA Change: S175P

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107417
AA Change: S20P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626
AA Change: S20P

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107422
SMART Domains Protein: ENSMUSP00000103045
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
CKS 1 52 3.88e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125036
AA Change: S9P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626
AA Change: S9P

DomainStartEndE-ValueType
PTB 1 155 1.5e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128238
AA Change: S65P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626
AA Change: S65P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 144 7.7e-19 PFAM
Pfam:PID 134 190 7.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137793
AA Change: S65P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117190
Gene: ENSMUSG00000042626
AA Change: S65P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154791
AA Change: S65P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123635
Gene: ENSMUSG00000042626
AA Change: S65P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 100 5.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183484
SMART Domains Protein: ENSMUSP00000138900
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
Pfam:CKS 5 36 2.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191485
AA Change: S65P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626
AA Change: S65P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes with a targeted mutation of the exon encoding the CH2 region show an extended life span, reduced cellular sensitivity to oxidative stress and UV irradiation, and resistance to diet-induced atherogenesis. Homozygotes lacking all three isoformsdie around E11.5 with cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Shc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Shc1 APN 3 89424229 missense probably damaging 0.99
IGL01608:Shc1 APN 3 89424849 missense probably damaging 0.96
IGL02710:Shc1 APN 3 89424610 splice site probably null
PIT4382001:Shc1 UTSW 3 89427408 missense probably benign 0.00
R0323:Shc1 UTSW 3 89423713 missense probably damaging 0.98
R0445:Shc1 UTSW 3 89426537 missense probably damaging 1.00
R0827:Shc1 UTSW 3 89426783 splice site probably null
R0833:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R0836:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R1155:Shc1 UTSW 3 89424819 missense probably benign 0.30
R1497:Shc1 UTSW 3 89428445 makesense probably null
R1929:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R2271:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R4402:Shc1 UTSW 3 89426678 missense probably benign
R4965:Shc1 UTSW 3 89426996 missense probably damaging 0.98
R5898:Shc1 UTSW 3 89426967 nonsense probably null
R6198:Shc1 UTSW 3 89422107 missense probably benign
R6604:Shc1 UTSW 3 89421879 missense probably damaging 1.00
R6673:Shc1 UTSW 3 89421962 missense possibly damaging 0.93
R6705:Shc1 UTSW 3 89422959 nonsense probably null
R7379:Shc1 UTSW 3 89426822 missense probably benign 0.00
R8284:Shc1 UTSW 3 89421908 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GCACGAAGTTCCTCTTTTGTGG -3'
(R):5'- ATTCTCTCACCGCCCATGAG -3'

Sequencing Primer
(F):5'- TGCCATACACCTATGAAGTGG -3'
(R):5'- TCACCGCCCATGAGAAGTC -3'
Posted On2020-01-23