Incidental Mutation 'R8047:Pbx2'
ID618839
Institutional Source Beutler Lab
Gene Symbol Pbx2
Ensembl Gene ENSMUSG00000034673
Gene Namepre B cell leukemia homeobox 2
SynonymsG17
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8047 (G1)
Quality Score212.009
Status Not validated
Chromosome17
Chromosomal Location34591266-34597400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34595288 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 350 (S350P)
Ref Sequence ENSEMBL: ENSMUSP00000040464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015596] [ENSMUST00000038149] [ENSMUST00000038244] [ENSMUST00000150924] [ENSMUST00000173328] [ENSMUST00000173772] [ENSMUST00000173992] [ENSMUST00000174069] [ENSMUST00000174496] [ENSMUST00000174532] [ENSMUST00000183827]
Predicted Effect probably benign
Transcript: ENSMUST00000015596
SMART Domains Protein: ENSMUSP00000015596
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 4.3e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038149
AA Change: S350P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040464
Gene: ENSMUSG00000034673
AA Change: S350P

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:PBC 50 243 1.3e-97 PFAM
HOX 244 309 1.9e-18 SMART
low complexity region 327 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038244
SMART Domains Protein: ENSMUSP00000045911
Gene: ENSMUSG00000034786

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
GoLoco 61 83 2.02e-6 SMART
low complexity region 86 100 N/A INTRINSIC
GoLoco 103 125 2.42e-4 SMART
GoLoco 131 154 4.05e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150924
Predicted Effect probably benign
Transcript: ENSMUST00000173328
AA Change: S268P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673
AA Change: S268P

DomainStartEndE-ValueType
Pfam:PBC 1 161 5e-84 PFAM
HOX 162 227 1.9e-18 SMART
low complexity region 245 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173772
SMART Domains Protein: ENSMUSP00000134130
Gene: ENSMUSG00000034786

DomainStartEndE-ValueType
GoLoco 27 50 4.05e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173992
SMART Domains Protein: ENSMUSP00000134579
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 108 3.23e-7 SMART
Pfam:C2-set_2 114 208 3.3e-24 PFAM
IGc2 239 297 7.63e-18 SMART
transmembrane domain 321 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174069
SMART Domains Protein: ENSMUSP00000133391
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 2.5e-24 PFAM
IGc2 248 306 7.63e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174496
SMART Domains Protein: ENSMUSP00000134401
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 3.4e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 330 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174532
SMART Domains Protein: ENSMUSP00000133744
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 148 3.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183827
AA Change: S290P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139079
Gene: ENSMUSG00000034673
AA Change: S290P

DomainStartEndE-ValueType
Pfam:PBC 1 183 9.5e-98 PFAM
HOX 184 249 1.9e-18 SMART
low complexity region 267 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed member of the TALE/PBX homeobox family. It was identified by its similarity to a homeobox gene which is involved in t(1;19) translocation in acute pre-B-cell leukemias. This protein is a transcriptional activator which binds to the TLX1 promoter. The gene is located within the major histocompatibility complex (MHC) on chromosome 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Pbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Pbx2 APN 17 34595618 splice site probably benign
IGL01923:Pbx2 APN 17 34594050 missense probably damaging 1.00
R1748:Pbx2 UTSW 17 34593977 missense possibly damaging 0.81
R2182:Pbx2 UTSW 17 34595666 nonsense probably null
R4257:Pbx2 UTSW 17 34594645 missense probably damaging 1.00
R5011:Pbx2 UTSW 17 34594699 nonsense probably null
R6161:Pbx2 UTSW 17 34593600 missense probably damaging 1.00
R6888:Pbx2 UTSW 17 34594107 missense possibly damaging 0.75
R8315:Pbx2 UTSW 17 34592733 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATGTCAAGGGGTAGCCTG -3'
(R):5'- GATGCCTCAGAGGGTTCTTG -3'

Sequencing Primer
(F):5'- CAAGGGGTAGCCTGTTGTGAG -3'
(R):5'- AGGTAACGCCTCCTGATCTGAG -3'
Posted On2020-01-23