Incidental Mutation 'R7620:Cyp39a1'
ID628270
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Namecytochrome P450, family 39, subfamily a, polypeptide 1
Synonymsoxysterol 7-alpha-hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7620 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location43667425-43751431 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 43725653 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
Predicted Effect probably null
Transcript: ENSMUST00000170988
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adnp2 T C 18: 80,130,487 T236A probably damaging Het
Alkbh7 A G 17: 56,997,551 Y63C probably damaging Het
Ccr9 T A 9: 123,779,846 C198S probably damaging Het
Chil3 T A 3: 106,160,435 D138V probably damaging Het
Cntd1 A T 11: 101,283,414 E66D probably benign Het
Cpz A T 5: 35,511,850 N312K possibly damaging Het
Crat A G 2: 30,408,078 I203T probably damaging Het
Cyp2j13 T A 4: 96,056,662 H410L probably benign Het
Dnah1 A T 14: 31,303,906 I828N possibly damaging Het
Dnah7b A G 1: 46,268,634 D3036G probably damaging Het
Dnpep A G 1: 75,313,448 V295A probably benign Het
Fam111a A G 19: 12,587,937 D394G possibly damaging Het
Fam26f A T 10: 34,127,618 C98S probably damaging Het
Fat1 A G 8: 45,009,850 K1235E possibly damaging Het
Gabre C A X: 72,270,259 Q311H unknown Het
Garem1 T C 18: 21,129,841 S639G probably benign Het
Gm11639 T A 11: 104,832,143 S1942T possibly damaging Het
Gsdma A G 11: 98,666,603 T123A probably benign Het
Iqcb1 A G 16: 36,856,410 N369S probably benign Het
Lepr G T 4: 101,752,073 V286F probably benign Het
Lgsn T C 1: 31,203,380 M181T probably benign Het
Mapk15 T G 15: 75,998,848 S512A probably benign Het
Mcm3ap A G 10: 76,470,433 T127A probably benign Het
Msto1 A G 3: 88,911,307 F315L possibly damaging Het
Myo5a T A 9: 75,164,136 D673E probably benign Het
Nup88 G C 11: 70,969,779 P58R probably benign Het
Olfr1267-ps1 A C 2: 90,085,633 I276R probably damaging Het
Olfr672 C A 7: 104,996,755 V50L possibly damaging Het
Ppp1r18 T C 17: 35,867,299 V22A probably benign Het
Psme1 T A 14: 55,580,340 C101* probably null Het
Rapgef4 G T 2: 72,229,078 C743F probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnmt T A 18: 68,314,034 Y330N probably damaging Het
Skint10 T A 4: 112,715,817 M261L possibly damaging Het
Slc35b1 T C 11: 95,387,865 Y192H probably damaging Het
Socs3 A G 11: 117,967,570 Y221H probably damaging Het
Spink12 A G 18: 44,104,617 probably benign Het
Sspo T C 6: 48,467,086 probably null Het
Trp73 G A 4: 154,059,257 Q551* probably null Het
Vmn2r45 C T 7: 8,483,223 W355* probably null Het
Wdr35 A G 12: 9,016,042 I678V probably benign Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
IGL03097:Cyp39a1 UTSW 17 43683050 nonsense probably null
R0230:Cyp39a1 UTSW 17 43732012 missense probably damaging 1.00
R1244:Cyp39a1 UTSW 17 43749945 missense probably benign 0.13
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4036:Cyp39a1 UTSW 17 43676940 missense probably damaging 0.97
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5197:Cyp39a1 UTSW 17 43746538 missense possibly damaging 0.67
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R6495:Cyp39a1 UTSW 17 43691694 missense probably benign 0.41
R7191:Cyp39a1 UTSW 17 43731019 nonsense probably null
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGTGAATCTACCTTCTGG -3'
(R):5'- GCTAGAGTGCAGAAATATTTTCGC -3'

Sequencing Primer
(F):5'- GTGAATCTACCTTCTGGTCTCTCTAG -3'
(R):5'- CGCACAAGAATTGATTAAGTGTGTG -3'
Posted On2020-02-21