Incidental Mutation 'IGL03097:Cyp39a1'
ID 453238
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Name cytochrome P450, family 39, subfamily a, polypeptide 1
Synonyms oxysterol 7-alpha-hydroxylase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # IGL03097 (G1)
Quality Score 218
Status Validated
Chromosome 17
Chromosomal Location 43667425-43751431 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 43683050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 200 (Y200*)
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
AlphaFold Q9JKJ9
Predicted Effect probably null
Transcript: ENSMUST00000170988
AA Change: Y200*
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963
AA Change: Y200*

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adcy9 T C 16: 4,418,066 T257A possibly damaging Het
Ahnak A G 19: 9,002,387 D345G probably benign Het
Ak5 A G 3: 152,660,514 probably null Het
Akap3 A G 6: 126,866,416 K666R probably damaging Het
Alpk3 A G 7: 81,093,909 N1158S probably benign Het
Atp23 A T 10: 126,887,687 V182E probably damaging Het
Atp4a A G 7: 30,723,037 D898G probably benign Het
Bnip3 T C 7: 138,894,479 N140S probably damaging Het
Bptf T C 11: 107,077,680 Y1059C probably damaging Het
Cacna1h A T 17: 25,391,144 I796N probably damaging Het
Ccnb2 A G 9: 70,409,396 probably benign Het
Cd3g T A 9: 44,970,763 D165V probably damaging Het
Cfap70 T C 14: 20,448,608 T4A probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cntn4 C T 6: 106,353,712 T97M probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crim1 C T 17: 78,367,798 T812I probably benign Het
Csmd1 G T 8: 15,945,127 T2636K probably damaging Het
Dlg4 T G 11: 70,042,202 I478S probably damaging Het
Dsc3 A T 18: 19,974,048 N505K probably benign Het
Efhc1 T C 1: 20,972,825 W323R probably damaging Het
Ehhadh T A 16: 21,762,770 I491L probably benign Het
Ggt6 T G 11: 72,436,813 H148Q possibly damaging Het
Gstm3 T C 3: 107,968,801 D25G probably benign Het
Gtf2h3 G A 5: 124,602,168 probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hnf4g A C 3: 3,651,614 E281A probably damaging Het
Impg1 T G 9: 80,379,952 E404A possibly damaging Het
Kcna2 T C 3: 107,105,399 V432A probably benign Het
Map3k2 T G 18: 32,200,017 D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp9 T A 2: 164,950,806 probably null Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Ms4a1 G T 19: 11,253,192 T215N probably benign Het
Pam16 T C 16: 4,616,594 I111V probably benign Het
Pde6c A G 19: 38,178,271 T720A probably damaging Het
Pgap2 T C 7: 102,236,227 L100P probably damaging Het
Ppl T A 16: 5,096,726 S686C probably damaging Het
Rnls A G 19: 33,138,279 probably benign Het
Robo3 A C 9: 37,422,528 probably null Het
Rptn G A 3: 93,397,373 G671D probably damaging Het
Slc6a21 C T 7: 45,288,168 Q628* probably null Het
Smg6 T G 11: 74,932,426 I708S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Vmn1r202 G A 13: 22,501,470 T259I probably benign Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
R0230:Cyp39a1 UTSW 17 43732012 missense probably damaging 1.00
R1244:Cyp39a1 UTSW 17 43749945 missense probably benign 0.13
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4036:Cyp39a1 UTSW 17 43676940 missense probably damaging 0.97
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5197:Cyp39a1 UTSW 17 43746538 missense possibly damaging 0.67
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R6495:Cyp39a1 UTSW 17 43691694 missense probably benign 0.41
R7191:Cyp39a1 UTSW 17 43731019 nonsense probably null
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R7620:Cyp39a1 UTSW 17 43725653 splice site probably null
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
R8483:Cyp39a1 UTSW 17 43683007 missense probably benign 0.01
R8549:Cyp39a1 UTSW 17 43730995 missense possibly damaging 0.95
R8964:Cyp39a1 UTSW 17 43691667 missense probably benign 0.02
R9730:Cyp39a1 UTSW 17 43680138 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAATGCTGCCTTTGTATCTAGA -3'
(R):5'- GGCAAGTGCAGTATATCCCC -3'

Sequencing Primer
(F):5'- CACAGGGTTGAGAACTGCCTATTC -3'
(R):5'- GTGCAAGCTTAAAGACCTGTGCTC -3'
Posted On 2017-01-31