Incidental Mutation 'R8105:Ugt3a1'
ID630695
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene NameUDP glycosyltransferases 3 family, polypeptide A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8105 (G1)
Quality Score193.009
Status Validated
Chromosome15
Chromosomal Location9276888-9315032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9306390 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 208 (F208L)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861]
Predicted Effect probably benign
Transcript: ENSMUST00000022861
AA Change: F208L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: F208L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid1b G A 17: 5,291,243 A941T possibly damaging Het
Calb1 A T 4: 15,900,767 probably null Het
Cc2d1b T C 4: 108,627,933 S518P possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cltc C T 11: 86,707,612 V975I probably damaging Het
Cntn4 T C 6: 106,353,606 W62R probably damaging Het
Crot A G 5: 8,977,505 Y276H probably damaging Het
Dnah5 T C 15: 28,372,402 V2933A probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fhod1 T C 8: 105,337,215 T253A unknown Het
Fndc3b G A 3: 27,470,225 T462I probably benign Het
Folh1 A T 7: 86,746,146 N359K probably damaging Het
Gmppa T C 1: 75,436,997 V34A possibly damaging Het
Ift140 A G 17: 25,036,975 T484A probably benign Het
Lrrtm2 T C 18: 35,213,457 E264G probably damaging Het
Luc7l2 T C 6: 38,592,653 F182S probably benign Het
Ly9 G C 1: 171,605,322 probably null Het
Meox2 C T 12: 37,109,062 H78Y possibly damaging Het
Mynn G A 3: 30,611,479 C420Y possibly damaging Het
Olfr670 C G 7: 104,960,422 M103I probably benign Het
Rfx1 C G 8: 84,087,876 A358G possibly damaging Het
Rnf151 G A 17: 24,716,426 T177I probably benign Het
Spef2 T G 15: 9,682,662 N578H probably benign Het
Stpg2 A G 3: 139,243,164 I240M probably damaging Het
Tln1 C T 4: 43,538,231 V1824I probably benign Het
Vldlr C T 19: 27,238,804 Q342* probably null Het
Vmn1r14 T A 6: 57,234,260 F274L probably benign Het
Xrcc6 T C 15: 82,031,151 L435P probably damaging Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R0841:Ugt3a1 UTSW 15 9306128 missense probably benign 0.07
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R3797:Ugt3a1 UTSW 15 9310641 nonsense probably null
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6344:Ugt3a1 UTSW 15 9306231 missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R6937:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9310693 nonsense probably null
R7840:Ugt3a1 UTSW 15 9311817 missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9284175 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGATTGTTGAAAAGCTTGGG -3'
(R):5'- AGCTAATGTGTCACTTACTTGGG -3'

Sequencing Primer
(F):5'- AAAGCTTGGGAAACGATTTGTGTC -3'
(R):5'- GCTGAACAGGTTTGTCCAGTAAAC -3'
Posted On2020-06-30