Incidental Mutation 'R9111:Ugt3a1'
ID 692266
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene Name UDP glycosyltransferases 3 family, polypeptide A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R9111 (G1)
Quality Score 101.008
Status Not validated
Chromosome 15
Chromosomal Location 9276888-9315032 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9306247 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 161 (F161L)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861]
AlphaFold Q3UP75
Predicted Effect possibly damaging
Transcript: ENSMUST00000022861
AA Change: F161L

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: F161L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 123,969,907 N210S Het
Adamts17 A G 7: 66,839,900 D22G probably damaging Het
Aldh3b1 T C 19: 3,921,797 E58G probably damaging Het
Atg2a G A 19: 6,261,504 A1830T probably damaging Het
Birc6 T C 17: 74,659,345 V4118A probably damaging Het
Ccdc28a G A 10: 18,225,002 P73S possibly damaging Het
Cdc42bpb A T 12: 111,318,469 D771E probably benign Het
Cdk14 G A 5: 5,265,985 P13S possibly damaging Het
Cdr2 G A 7: 120,960,122 S158F possibly damaging Het
Cfap44 A T 16: 44,431,963 T812S probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cp A T 3: 19,973,785 I452F probably damaging Het
Dcdc2c T A 12: 28,535,489 I2F probably damaging Het
Dock1 A G 7: 134,999,288 D984G possibly damaging Het
Dsc2 T C 18: 20,034,707 I710V probably benign Het
Eif4e A G 3: 138,546,361 E20G probably benign Het
Fbxw16 T C 9: 109,436,611 Y380C probably damaging Het
Fscn3 A G 6: 28,430,311 D160G probably damaging Het
Gm11361 T A 13: 28,257,643 L3Q probably damaging Het
Gm9195 G A 14: 72,456,683 Q1531* probably null Het
Hps3 T C 3: 20,030,411 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igsf1 C T X: 49,786,859 E755K probably null Het
Kalrn A G 16: 34,361,001 V89A probably damaging Het
Kcng1 C A 2: 168,262,615 G437V probably damaging Het
Krt82 C T 15: 101,543,351 R343Q probably benign Het
Lbr T C 1: 181,817,503 D528G possibly damaging Het
Macf1 T C 4: 123,513,026 E256G probably damaging Het
Mmp9 T A 2: 164,950,806 probably null Het
Myrf A G 19: 10,214,057 probably null Het
Ncor1 T A 11: 62,389,759 T82S possibly damaging Het
Olfr1212 G A 2: 88,958,711 V82I probably benign Het
P2rx6 G T 16: 17,567,763 W176L probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pik3c2a A G 7: 116,394,296 V412A probably damaging Het
Prkd2 A G 7: 16,850,206 E328G probably benign Het
Prmt1 A C 7: 44,981,745 V114G probably damaging Het
Rnf133 G A 6: 23,648,929 H334Y probably benign Het
Secisbp2l A G 2: 125,760,286 S385P probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sfpq CCAGCAGCAGCAGCAGC CCAGCAGCAGCAGC 4: 127,021,608 probably benign Het
Slc35e1 G A 8: 72,492,186 P134L Het
Slc9a3 A G 13: 74,150,801 Y113C probably damaging Het
Zhx2 T C 15: 57,822,588 I451T probably damaging Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R0841:Ugt3a1 UTSW 15 9306128 missense probably benign 0.07
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R3797:Ugt3a1 UTSW 15 9310641 nonsense probably null
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6344:Ugt3a1 UTSW 15 9306231 missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R6937:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9310693 nonsense probably null
R7840:Ugt3a1 UTSW 15 9311817 missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9284175 critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9306390 missense probably benign 0.00
R8414:Ugt3a1 UTSW 15 9310583 missense possibly damaging 0.82
R8981:Ugt3a1 UTSW 15 9311928 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCATAACATCATTCCAAATAGTGTG -3'
(R):5'- CGCAAAATGCTCCTGGACAG -3'

Sequencing Primer
(F):5'- TTATTGCAGGTCCAAATATCACACC -3'
(R):5'- CGCAAAATGCTCCTGGACAGTATTG -3'
Posted On 2021-12-30