Incidental Mutation 'R5693:Tiparp'
ID443757
Institutional Source Beutler Lab
Gene Symbol Tiparp
Ensembl Gene ENSMUSG00000034640
Gene NameTCDD-inducible poly(ADP-ribose) polymerase
SynonymsPARP7, PARP-7, DDF1
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location65528410-65555518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65553492 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 634 (I634T)
Ref Sequence ENSEMBL: ENSMUSP00000048051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047906
AA Change: I634T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048051
Gene: ENSMUSG00000034640
AA Change: I634T

DomainStartEndE-ValueType
Blast:ZnF_C3H1 238 264 2e-8 BLAST
Pfam:PARP 463 650 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154094
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects, kidney defects and embryonic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Rnf183 A G 4: 62,428,516 V15A possibly damaging Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Tiparp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Tiparp APN 3 65532109 missense probably damaging 1.00
IGL01448:Tiparp APN 3 65552609 nonsense probably null
IGL01452:Tiparp APN 3 65552609 nonsense probably null
IGL01454:Tiparp APN 3 65552609 nonsense probably null
IGL01456:Tiparp APN 3 65552609 nonsense probably null
IGL01463:Tiparp APN 3 65552609 nonsense probably null
IGL01467:Tiparp APN 3 65552609 nonsense probably null
IGL01468:Tiparp APN 3 65552609 nonsense probably null
IGL01470:Tiparp APN 3 65552609 nonsense probably null
IGL01476:Tiparp APN 3 65552609 nonsense probably null
IGL01481:Tiparp APN 3 65552609 nonsense probably null
IGL01590:Tiparp APN 3 65531976 missense probably benign 0.14
IGL01684:Tiparp APN 3 65553333 missense probably damaging 0.99
IGL02322:Tiparp APN 3 65532020 nonsense probably null
IGL02572:Tiparp APN 3 65531889 missense probably benign 0.01
BB003:Tiparp UTSW 3 65553525 missense possibly damaging 0.61
BB013:Tiparp UTSW 3 65553525 missense possibly damaging 0.61
R0401:Tiparp UTSW 3 65531436 missense probably benign 0.06
R0674:Tiparp UTSW 3 65553165 missense probably benign 0.03
R1316:Tiparp UTSW 3 65553351 missense probably damaging 1.00
R1766:Tiparp UTSW 3 65532049 missense probably damaging 1.00
R2140:Tiparp UTSW 3 65529252 intron probably benign
R2568:Tiparp UTSW 3 65553130 nonsense probably null
R4533:Tiparp UTSW 3 65546347 missense probably benign 0.05
R4751:Tiparp UTSW 3 65552804 missense probably damaging 1.00
R4812:Tiparp UTSW 3 65552769 missense possibly damaging 0.94
R5268:Tiparp UTSW 3 65547565 missense possibly damaging 0.72
R5622:Tiparp UTSW 3 65547525 missense probably benign 0.00
R5765:Tiparp UTSW 3 65531350 missense possibly damaging 0.69
R6061:Tiparp UTSW 3 65553243 missense probably damaging 0.98
R6875:Tiparp UTSW 3 65531642 missense probably benign 0.01
R7123:Tiparp UTSW 3 65553527 missense probably damaging 1.00
R7926:Tiparp UTSW 3 65553525 missense possibly damaging 0.61
R8023:Tiparp UTSW 3 65531803 missense probably benign 0.01
R8234:Tiparp UTSW 3 65531581 missense probably benign
R8416:Tiparp UTSW 3 65531346 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTATTTCGCAAAGAAGGCAAGC -3'
(R):5'- GGGTCTGAAAAGTATCCTATTTCTGTC -3'

Sequencing Primer
(F):5'- TATTTCGCAAAGAAGGCAAGCTACTC -3'
(R):5'- AGTATCCTATTTCTGTCAAATGCTG -3'
Posted On2016-11-09