Incidental Mutation 'R8250:Sox5'
ID640281
Institutional Source Beutler Lab
Gene Symbol Sox5
Ensembl Gene ENSMUSG00000041540
Gene NameSRY (sex determining region Y)-box 5
SynonymsA730017D01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location143828425-144781977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144155051 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 71 (S71T)
Ref Sequence ENSEMBL: ENSMUSP00000047567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038815] [ENSMUST00000077160] [ENSMUST00000111749] [ENSMUST00000170367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038815
AA Change: S71T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047567
Gene: ENSMUSG00000041540
AA Change: S71T

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 431 445 N/A INTRINSIC
coiled coil region 449 483 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HMG 555 625 2.84e-26 SMART
low complexity region 686 708 N/A INTRINSIC
low complexity region 729 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077160
AA Change: S71T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076403
Gene: ENSMUSG00000041540
AA Change: S71T

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 277 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
coiled coil region 401 435 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
HMG 507 577 2.84e-26 SMART
low complexity region 638 660 N/A INTRINSIC
low complexity region 681 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111749
SMART Domains Protein: ENSMUSP00000107378
Gene: ENSMUSG00000041540

DomainStartEndE-ValueType
low complexity region 132 143 N/A INTRINSIC
coiled coil region 158 237 N/A INTRINSIC
low complexity region 347 361 N/A INTRINSIC
coiled coil region 365 399 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
HMG 471 541 2.84e-26 SMART
low complexity region 602 624 N/A INTRINSIC
low complexity region 645 666 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170367
AA Change: S71T

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133041
Gene: ENSMUSG00000041540
AA Change: S71T

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
coiled coil region 400 434 N/A INTRINSIC
low complexity region 445 456 N/A INTRINSIC
HMG 506 576 2.84e-26 SMART
low complexity region 637 659 N/A INTRINSIC
low complexity region 680 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to breathe and die at birth exhibiting a narrow thoracic cage, irregularly mineralized sternum, cleft secondary palate, and delayed bone mineralization. Homozygotes for a transposon induced insertion die shortly after birth exhibiting cyanosis and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Sox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Sox5 APN 6 144116472 missense probably damaging 0.96
IGL03217:Sox5 APN 6 143907497 missense probably damaging 1.00
Stocking UTSW 6 144116443 critical splice donor site probably null
R0230:Sox5 UTSW 6 144209338 missense probably benign 0.02
R0610:Sox5 UTSW 6 143833439 missense possibly damaging 0.56
R1162:Sox5 UTSW 6 143960812 missense probably damaging 1.00
R1857:Sox5 UTSW 6 143960815 missense probably damaging 1.00
R1959:Sox5 UTSW 6 143874105 missense possibly damaging 0.94
R4057:Sox5 UTSW 6 144116522 missense probably damaging 1.00
R4164:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R4284:Sox5 UTSW 6 143835329 missense probably damaging 1.00
R4430:Sox5 UTSW 6 144041274 missense possibly damaging 0.57
R4470:Sox5 UTSW 6 143844765 missense possibly damaging 0.54
R4471:Sox5 UTSW 6 143844765 missense possibly damaging 0.54
R4672:Sox5 UTSW 6 143833349 missense probably damaging 1.00
R4683:Sox5 UTSW 6 143833467 missense probably damaging 0.99
R4693:Sox5 UTSW 6 143835316 missense probably damaging 1.00
R4735:Sox5 UTSW 6 143960835 missense probably damaging 1.00
R4745:Sox5 UTSW 6 143833488 missense possibly damaging 0.53
R4762:Sox5 UTSW 6 143861383 critical splice donor site probably null
R4996:Sox5 UTSW 6 144028344 nonsense probably null
R5218:Sox5 UTSW 6 143960890 missense possibly damaging 0.93
R5673:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R5856:Sox5 UTSW 6 144209362 missense probably damaging 1.00
R6249:Sox5 UTSW 6 143833283 missense probably benign 0.33
R6394:Sox5 UTSW 6 144041313 missense probably damaging 1.00
R6703:Sox5 UTSW 6 143833465 missense probably damaging 1.00
R6812:Sox5 UTSW 6 144116443 critical splice donor site probably null
R7312:Sox5 UTSW 6 144155033 missense probably benign
R7543:Sox5 UTSW 6 143841179 missense probably damaging 0.96
R8110:Sox5 UTSW 6 144116474 missense possibly damaging 0.92
R8231:Sox5 UTSW 6 144028288 missense probably damaging 0.98
R8705:Sox5 UTSW 6 144041286 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TATGAGGCCTGCTGTGAATC -3'
(R):5'- CCACACAATGACGGCATTAAGG -3'

Sequencing Primer
(F):5'- AATCGTCTGTGTGGTTCTTAGAAAC -3'
(R):5'- AATGACGGCATTAAGGATTTATGTGG -3'
Posted On2020-07-28