Incidental Mutation 'R8231:Sox5'
ID637141
Institutional Source Beutler Lab
Gene Symbol Sox5
Ensembl Gene ENSMUSG00000041540
Gene NameSRY (sex determining region Y)-box 5
SynonymsA730017D01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location143828425-144781977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 144028288 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 245 (Q245K)
Ref Sequence ENSEMBL: ENSMUSP00000047567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038815] [ENSMUST00000077160] [ENSMUST00000111749] [ENSMUST00000170367]
Predicted Effect probably damaging
Transcript: ENSMUST00000038815
AA Change: Q245K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047567
Gene: ENSMUSG00000041540
AA Change: Q245K

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 431 445 N/A INTRINSIC
coiled coil region 449 483 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HMG 555 625 2.84e-26 SMART
low complexity region 686 708 N/A INTRINSIC
low complexity region 729 750 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077160
AA Change: Q245K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076403
Gene: ENSMUSG00000041540
AA Change: Q245K

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 277 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
coiled coil region 401 435 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
HMG 507 577 2.84e-26 SMART
low complexity region 638 660 N/A INTRINSIC
low complexity region 681 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111749
AA Change: Q210K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107378
Gene: ENSMUSG00000041540
AA Change: Q210K

DomainStartEndE-ValueType
low complexity region 132 143 N/A INTRINSIC
coiled coil region 158 237 N/A INTRINSIC
low complexity region 347 361 N/A INTRINSIC
coiled coil region 365 399 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
HMG 471 541 2.84e-26 SMART
low complexity region 602 624 N/A INTRINSIC
low complexity region 645 666 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170367
AA Change: Q245K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133041
Gene: ENSMUSG00000041540
AA Change: Q245K

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
coiled coil region 400 434 N/A INTRINSIC
low complexity region 445 456 N/A INTRINSIC
HMG 506 576 2.84e-26 SMART
low complexity region 637 659 N/A INTRINSIC
low complexity region 680 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to breathe and die at birth exhibiting a narrow thoracic cage, irregularly mineralized sternum, cleft secondary palate, and delayed bone mineralization. Homozygotes for a transposon induced insertion die shortly after birth exhibiting cyanosis and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Sox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Sox5 APN 6 144116472 missense probably damaging 0.96
IGL03217:Sox5 APN 6 143907497 missense probably damaging 1.00
Stocking UTSW 6 144116443 critical splice donor site probably null
R0230:Sox5 UTSW 6 144209338 missense probably benign 0.02
R0610:Sox5 UTSW 6 143833439 missense possibly damaging 0.56
R1162:Sox5 UTSW 6 143960812 missense probably damaging 1.00
R1857:Sox5 UTSW 6 143960815 missense probably damaging 1.00
R1959:Sox5 UTSW 6 143874105 missense possibly damaging 0.94
R4057:Sox5 UTSW 6 144116522 missense probably damaging 1.00
R4164:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R4284:Sox5 UTSW 6 143835329 missense probably damaging 1.00
R4430:Sox5 UTSW 6 144041274 missense possibly damaging 0.57
R4470:Sox5 UTSW 6 143844765 missense possibly damaging 0.54
R4471:Sox5 UTSW 6 143844765 missense possibly damaging 0.54
R4672:Sox5 UTSW 6 143833349 missense probably damaging 1.00
R4683:Sox5 UTSW 6 143833467 missense probably damaging 0.99
R4693:Sox5 UTSW 6 143835316 missense probably damaging 1.00
R4735:Sox5 UTSW 6 143960835 missense probably damaging 1.00
R4745:Sox5 UTSW 6 143833488 missense possibly damaging 0.53
R4762:Sox5 UTSW 6 143861383 critical splice donor site probably null
R4996:Sox5 UTSW 6 144028344 nonsense probably null
R5218:Sox5 UTSW 6 143960890 missense possibly damaging 0.93
R5673:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R5856:Sox5 UTSW 6 144209362 missense probably damaging 1.00
R6249:Sox5 UTSW 6 143833283 missense probably benign 0.33
R6394:Sox5 UTSW 6 144041313 missense probably damaging 1.00
R6703:Sox5 UTSW 6 143833465 missense probably damaging 1.00
R6812:Sox5 UTSW 6 144116443 critical splice donor site probably null
R7312:Sox5 UTSW 6 144155033 missense probably benign
R7543:Sox5 UTSW 6 143841179 missense probably damaging 0.96
R8110:Sox5 UTSW 6 144116474 missense possibly damaging 0.92
R8250:Sox5 UTSW 6 144155051 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTTCCCACACCCGAAAGTAG -3'
(R):5'- ATGGAAATGTGGCCGCCTTC -3'

Sequencing Primer
(F):5'- CACCCGAAAGTAGTTATACAGTTC -3'
(R):5'- GAAATGTGGCCGCCTTCTCAATTC -3'
Posted On2020-07-13