Mutagenetix > Incidental Mutations

Incidental Mutation 'R1959:Sox5'

218146

Institutional Source

Beutler Lab

Gene Symbol

Sox5

Ensembl Gene

ENSMUSG00000041540

Gene Name

SRY (sex determining region Y)-box 5

Synonyms

A730017D01Rik

MMRRC Submission

039973-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1959 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143828425-144781977 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143874105 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 62 (S62P)

Ref Sequence

ENSEMBL: ENSMUSP00000114602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038815] [ENSMUST00000077160] [ENSMUST00000111748] [ENSMUST00000111749] [ENSMUST00000124233] [ENSMUST00000144289] [ENSMUST00000170367]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038815
AA Change: S404P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000047567
Gene: ENSMUSG00000041540
AA Change: S404P

Domain	Start	End	E-Value	Type
low complexity region	167	178	N/A	INTRINSIC
coiled coil region	193	272	N/A	INTRINSIC
low complexity region	336	348	N/A	INTRINSIC
low complexity region	431	445	N/A	INTRINSIC
coiled coil region	449	483	N/A	INTRINSIC
low complexity region	494	505	N/A	INTRINSIC
HMG	555	625	2.84e-26	SMART
low complexity region	686	708	N/A	INTRINSIC
low complexity region	729	750	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000077160
AA Change: S356P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000076403
Gene: ENSMUSG00000041540
AA Change: S356P

Domain	Start	End	E-Value	Type
low complexity region	167	178	N/A	INTRINSIC
coiled coil region	193	277	N/A	INTRINSIC
low complexity region	383	397	N/A	INTRINSIC
coiled coil region	401	435	N/A	INTRINSIC
low complexity region	446	457	N/A	INTRINSIC
HMG	507	577	2.84e-26	SMART
low complexity region	638	660	N/A	INTRINSIC
low complexity region	681	702	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111746

SMART Domains

Protein: ENSMUSP00000107375
Gene: ENSMUSG00000041540

Domain	Start	End	E-Value	Type
low complexity region	60	74	N/A	INTRINSIC
coiled coil region	78	112	N/A	INTRINSIC
low complexity region	123	134	N/A	INTRINSIC
HMG	184	234	1.72e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111748
AA Change: S33P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107377
Gene: ENSMUSG00000041540
AA Change: S33P

Domain	Start	End	E-Value	Type
low complexity region	60	74	N/A	INTRINSIC
coiled coil region	78	112	N/A	INTRINSIC
low complexity region	123	134	N/A	INTRINSIC
HMG	184	254	2.84e-26	SMART
low complexity region	315	337	N/A	INTRINSIC
low complexity region	358	379	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111749
AA Change: S320P

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107378
Gene: ENSMUSG00000041540
AA Change: S320P

Domain	Start	End	E-Value	Type
low complexity region	132	143	N/A	INTRINSIC
coiled coil region	158	237	N/A	INTRINSIC
low complexity region	347	361	N/A	INTRINSIC
coiled coil region	365	399	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
HMG	471	541	2.84e-26	SMART
low complexity region	602	624	N/A	INTRINSIC
low complexity region	645	666	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124233
AA Change: S62P

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114602
Gene: ENSMUSG00000041540
AA Change: S62P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	89	103	N/A	INTRINSIC
coiled coil region	107	141	N/A	INTRINSIC
low complexity region	152	163	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141102

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144289
AA Change: S82P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122786
Gene: ENSMUSG00000041540
AA Change: S82P

Domain	Start	End	E-Value	Type
low complexity region	14	26	N/A	INTRINSIC
low complexity region	109	123	N/A	INTRINSIC
coiled coil region	127	161	N/A	INTRINSIC
low complexity region	172	183	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170367
AA Change: S355P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133041
Gene: ENSMUSG00000041540
AA Change: S355P

Domain	Start	End	E-Value	Type
low complexity region	167	178	N/A	INTRINSIC
coiled coil region	193	272	N/A	INTRINSIC
low complexity region	382	396	N/A	INTRINSIC
coiled coil region	400	434	N/A	INTRINSIC
low complexity region	445	456	N/A	INTRINSIC
HMG	506	576	2.84e-26	SMART
low complexity region	637	659	N/A	INTRINSIC
low complexity region	680	701	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to breathe and die at birth exhibiting a narrow thoracic cage, irregularly mineralized sternum, cleft secondary palate, and delayed bone mineralization. Homozygotes for a transposon induced insertion die shortly after birth exhibiting cyanosis and respiratory distress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Aco1	T	C	4: 40,167,193		probably null	Het
Adap1	A	G	5: 139,273,341	Y364H	probably benign	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgb	A	T	10: 10,395,249	D883E	probably benign	Het
Als2cr12	A	T	1: 58,659,278	V327D	possibly damaging	Het
Anapc1	C	A	2: 128,633,415	R1381S	probably benign	Het
Aoah	A	G	13: 20,794,394	M1V	probably null	Het
Arap1	C	A	7: 101,373,015	A8E	probably damaging	Het
Arhgap10	A	G	8: 77,409,626	F319S	possibly damaging	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cabin1	A	T	10: 75,735,090	V784E	possibly damaging	Het
Card9	T	A	2: 26,354,873		probably null	Het
Cdk18	A	G	1: 132,117,821	I238T	possibly damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Commd3	A	T	2: 18,673,963	I70F	probably benign	Het
Cspg5	G	A	9: 110,251,026	V340M	probably damaging	Het
Cyb5r4	G	A	9: 87,055,849	S307N	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Ddx11	A	G	17: 66,130,728	M150V	probably benign	Het
Dennd4b	A	G	3: 90,268,773	Y190C	probably damaging	Het
Det1	A	G	7: 78,843,443	V271A	probably benign	Het
Dgkd	C	A	1: 87,929,827	P754T	possibly damaging	Het
Dhx36	T	C	3: 62,479,385	S649G	probably benign	Het
Dlgap5	A	G	14: 47,416,386	I62T	possibly damaging	Het
Dmgdh	A	G	13: 93,720,559	M724V	probably benign	Het
Dnah7a	A	G	1: 53,684,983	S108P	probably benign	Het
Dock4	A	T	12: 40,710,798	K495M	probably damaging	Het
Dse	A	G	10: 34,160,206	Y225H	probably damaging	Het
Emx1	G	A	6: 85,203,934	R211K	probably damaging	Het
Ergic2	A	G	6: 148,199,354		probably null	Het
Fbxo27	G	A	7: 28,698,372	C277Y	possibly damaging	Het
Fcrl1	T	C	3: 87,376,520	I9T	possibly damaging	Het
Fjx1	T	C	2: 102,450,807	E261G	probably benign	Het
Flnb	C	T	14: 7,884,735	Q445*	probably null	Het
Flrt2	G	A	12: 95,780,300	V471I	probably benign	Het
Frmd4a	G	A	2: 4,535,186	V210M	probably damaging	Het
Fsip2	A	G	2: 82,991,550	K5876E	probably benign	Het
Galnt10	T	C	11: 57,765,617	L209P	probably damaging	Het
Gata5	A	T	2: 180,326,936	S382T	possibly damaging	Het
Glt6d1	C	A	2: 25,794,413	V194L	probably damaging	Het
Gm10803	T	G	2: 93,563,943	V20G	unknown	Het
Gm44511	T	G	6: 128,820,271	T52P	probably damaging	Het
Gpat4	A	T	8: 23,182,936	L88Q	possibly damaging	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Hivep2	A	T	10: 14,132,709	I1684F	probably benign	Het
Hmcn1	T	C	1: 150,649,676	T3366A	probably benign	Het
Hnmt	A	G	2: 24,003,882	V200A	possibly damaging	Het
Hps6	A	T	19: 46,004,335	H237L	probably benign	Het
Hspg2	C	T	4: 137,564,895	P4033S	probably damaging	Het
Irf9	T	A	14: 55,607,717	S297T	possibly damaging	Het
Kdm3b	T	C	18: 34,812,395	V753A	possibly damaging	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Krtap4-16	A	G	11: 99,851,547	V9A	unknown	Het
Lama2	G	T	10: 27,422,618	P161T	probably damaging	Het
Ltbp4	G	A	7: 27,329,018	P273L	unknown	Het
Lvrn	T	A	18: 46,894,717	S866R	probably damaging	Het
Med13	A	G	11: 86,298,979	Y1035H	probably damaging	Het
Mertk	T	A	2: 128,759,090	N331K	probably damaging	Het
Mios	T	A	6: 8,215,437	F211Y	probably benign	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Mphosph9	A	T	5: 124,315,701	S183T	possibly damaging	Het
Mrto4	A	T	4: 139,349,638	I56N	probably damaging	Het
Muc5b	T	C	7: 141,862,637	C3107R	possibly damaging	Het
Ncoa2	A	G	1: 13,160,252	Y1023H	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nlrp6	GAGAAGAAGAAGAAGAAGAAGA	GAGAAGAAGAAGAAGAAGA	7: 140,924,113		probably benign	Het
Nr2f1	T	C	13: 78,189,816	T237A	probably damaging	Het
Nup205	C	A	6: 35,233,366	Q1621K	probably benign	Het
Nxpe2	T	A	9: 48,319,726	S448C	probably benign	Het
Ogdh	T	A	11: 6,346,638	C498S	possibly damaging	Het
Olfr1176	T	C	2: 88,340,201	L212P	probably damaging	Het
Olfr281	T	C	15: 98,456,753	S148P	probably damaging	Het
Olfr294	A	T	7: 86,616,431	F71L	probably benign	Het
Olfr414	A	T	1: 174,430,905	K159M	probably damaging	Het
Olfr697	T	C	7: 106,741,394	E180G	probably damaging	Het
Olfr715	A	T	7: 107,128,510	D294E	possibly damaging	Het
Olfr994	T	C	2: 85,430,619	D70G	probably damaging	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Pcdhb9	T	A	18: 37,403,316	Y788N	probably damaging	Het
Pcsk5	T	C	19: 17,433,418	D1870G	unknown	Het
Pde6g	A	G	11: 120,448,136	L76P	probably damaging	Het
Peak1	A	T	9: 56,206,789	Y593N	probably damaging	Het
Pfas	C	T	11: 68,994,284	G16R	probably damaging	Het
Pkd1l2	A	T	8: 117,043,231		probably null	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Ptpru	T	A	4: 131,803,477	I489F	probably damaging	Het
Rere	T	G	4: 150,468,790	H146Q	probably benign	Het
Rundc1	A	T	11: 101,431,496	Q272L	probably damaging	Het
Scml4	T	C	10: 42,956,021	L305P	probably damaging	Het
Sec16a	A	T	2: 26,430,132	H1431Q	probably benign	Het
Serpina1a	G	A	12: 103,853,800	Q373*	probably null	Het
Shank1	A	T	7: 44,325,377	N377I	unknown	Het
Shc2	T	C	10: 79,626,791		probably null	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc7a2	A	T	8: 40,914,965	I589F	probably damaging	Het
Smim8	C	T	4: 34,771,316	R26Q	probably damaging	Het
Smox	C	A	2: 131,520,464	A221D	probably damaging	Het
Spg21	A	C	9: 65,484,492	K240N	probably damaging	Het
Sv2c	C	T	13: 95,976,645	V599M	probably damaging	Het
Tanc2	T	A	11: 105,910,295	H1112Q	probably damaging	Het
Tbata	T	C	10: 61,175,844	I58T	possibly damaging	Het
Tbc1d2	T	G	4: 46,606,419	Y842S	probably benign	Het
Tctn1	A	T	5: 122,241,840		probably null	Het
Tenm1	T	C	X: 42,827,201	D402G	probably benign	Het
Tfcp2l1	T	C	1: 118,669,389	V400A	probably benign	Het
Tm9sf2	T	A	14: 122,126,164	L99I	probably benign	Het
Top2a	T	C	11: 98,995,977		probably null	Het
Traf7	C	A	17: 24,513,281	G191C	probably damaging	Het
Trpm1	T	A	7: 64,230,230	L661Q	probably damaging	Het
Ttc30b	C	T	2: 75,937,099	E437K	probably benign	Het
Ttn	T	C	2: 76,750,623	I23309V	probably benign	Het
Usp50	T	C	2: 126,777,961	K199E	possibly damaging	Het
Vmn1r218	T	C	13: 23,136,513	F10S	probably damaging	Het
Vmn2r89	C	A	14: 51,457,440	T459K	probably benign	Het
Vps13a	T	G	19: 16,677,938	S1909R	possibly damaging	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Vwa8	A	G	14: 78,982,360	H516R	possibly damaging	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het
Zfat	G	C	15: 68,146,543	P974R	probably benign	Het
Zfc3h1	T	A	10: 115,423,253	I1601K	probably benign	Het
Zfp239	A	G	6: 117,871,817	K172R	probably benign	Het
Zfp335	C	T	2: 164,894,802	G971D	probably damaging	Het
Zfp532	A	T	18: 65,624,492	I499F	probably damaging	Het
Zfp647	T	C	15: 76,911,114	T449A	possibly damaging	Het
Zfp938	C	T	10: 82,225,631	G385D	probably damaging	Het
Zfp959	T	G	17: 55,897,404	V147G	probably damaging	Het
Znfx1	A	T	2: 167,050,350	C649S	probably damaging	Het

Other mutations in Sox5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Sox5	APN	6	144116472	missense	probably damaging	0.96
IGL03217:Sox5	APN	6	143907497	missense	probably damaging	1.00
Stocking	UTSW	6	144116443	critical splice donor site	probably null
R0230:Sox5	UTSW	6	144209338	missense	probably benign	0.02
R0610:Sox5	UTSW	6	143833439	missense	possibly damaging	0.56
R1162:Sox5	UTSW	6	143960812	missense	probably damaging	1.00
R1857:Sox5	UTSW	6	143960815	missense	probably damaging	1.00
R4057:Sox5	UTSW	6	144116522	missense	probably damaging	1.00
R4164:Sox5	UTSW	6	144116480	missense	probably damaging	1.00
R4284:Sox5	UTSW	6	143835329	missense	probably damaging	1.00
R4430:Sox5	UTSW	6	144041274	missense	possibly damaging	0.57
R4470:Sox5	UTSW	6	143844765	missense	possibly damaging	0.54
R4471:Sox5	UTSW	6	143844765	missense	possibly damaging	0.54
R4672:Sox5	UTSW	6	143833349	missense	probably damaging	1.00
R4683:Sox5	UTSW	6	143833467	missense	probably damaging	0.99
R4693:Sox5	UTSW	6	143835316	missense	probably damaging	1.00
R4735:Sox5	UTSW	6	143960835	missense	probably damaging	1.00
R4745:Sox5	UTSW	6	143833488	missense	possibly damaging	0.53
R4762:Sox5	UTSW	6	143861383	critical splice donor site	probably null
R4996:Sox5	UTSW	6	144028344	nonsense	probably null
R5218:Sox5	UTSW	6	143960890	missense	possibly damaging	0.93
R5673:Sox5	UTSW	6	144116480	missense	probably damaging	1.00
R5856:Sox5	UTSW	6	144209362	missense	probably damaging	1.00
R6249:Sox5	UTSW	6	143833283	missense	probably benign	0.33
R6394:Sox5	UTSW	6	144041313	missense	probably damaging	1.00
R6703:Sox5	UTSW	6	143833465	missense	probably damaging	1.00
R6812:Sox5	UTSW	6	144116443	critical splice donor site	probably null
R7312:Sox5	UTSW	6	144155033	missense	probably benign
R7543:Sox5	UTSW	6	143841179	missense	probably damaging	0.96
R8110:Sox5	UTSW	6	144116474	missense	possibly damaging	0.92
R8231:Sox5	UTSW	6	144028288	missense	probably damaging	0.98
R8250:Sox5	UTSW	6	144155051	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- TGCCGTGAATGGGAAATCAATG -3'
(R):5'- TGTGAGCTTCCTGTTGCAC -3'

Sequencing Primer
(F):5'- CCGTGAATGGGAAATCAATGAGAAC -3'
(R):5'- GAGCTTCCTGTTGCACAACCAG -3'

Posted On

2014-08-01