Incidental Mutation 'R8250:Zfp786'
ID640279
Institutional Source Beutler Lab
Gene Symbol Zfp786
Ensembl Gene ENSMUSG00000051499
Gene Namezinc finger protein 786
SynonymsA730012O14Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177882; MGI: 3026883

Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location47819266-47830867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47820795 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 403 (L403Q)
Ref Sequence ENSEMBL: ENSMUSP00000057495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058844]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058844
AA Change: L403Q

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057495
Gene: ENSMUSG00000051499
AA Change: L403Q

DomainStartEndE-ValueType
KRAB 9 69 2.6e-22 SMART
low complexity region 156 164 N/A INTRINSIC
ZnF_C2H2 240 262 5.34e-1 SMART
ZnF_C2H2 268 295 1.41e2 SMART
ZnF_C2H2 420 440 1.21e2 SMART
ZnF_C2H2 448 470 3.52e-1 SMART
ZnF_C2H2 476 498 1.89e-1 SMART
ZnF_C2H2 504 526 1.69e-3 SMART
ZnF_C2H2 532 554 5.59e-4 SMART
ZnF_C2H2 560 582 4.79e-3 SMART
ZnF_C2H2 588 610 3.69e-4 SMART
ZnF_C2H2 616 638 3.63e-3 SMART
ZnF_C2H2 644 665 5.92e0 SMART
ZnF_C2H2 671 693 2.57e-3 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 1.45e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Other mutations in Zfp786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp786 APN 6 47819671 makesense probably null
IGL02442:Zfp786 APN 6 47821367 missense probably benign 0.00
IGL02674:Zfp786 APN 6 47820493 missense probably benign 0.22
IGL02814:Zfp786 APN 6 47819841 missense probably damaging 1.00
IGL03072:Zfp786 APN 6 47821243 missense probably benign 0.01
IGL03294:Zfp786 APN 6 47821324 nonsense probably null
IGL03393:Zfp786 APN 6 47821524 missense possibly damaging 0.88
3-1:Zfp786 UTSW 6 47820445 missense probably damaging 1.00
PIT4581001:Zfp786 UTSW 6 47819822 missense probably damaging 1.00
R1071:Zfp786 UTSW 6 47821305 missense possibly damaging 0.91
R1426:Zfp786 UTSW 6 47825079 missense probably benign 0.17
R1976:Zfp786 UTSW 6 47819757 missense probably damaging 1.00
R2114:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2115:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2117:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2176:Zfp786 UTSW 6 47820971 missense possibly damaging 0.65
R2304:Zfp786 UTSW 6 47820699 missense probably damaging 1.00
R3110:Zfp786 UTSW 6 47820226 missense probably damaging 1.00
R3112:Zfp786 UTSW 6 47820226 missense probably damaging 1.00
R3623:Zfp786 UTSW 6 47821423 missense probably benign 0.00
R4654:Zfp786 UTSW 6 47820934 missense probably benign 0.01
R4741:Zfp786 UTSW 6 47820691 missense probably damaging 1.00
R4927:Zfp786 UTSW 6 47820153 missense probably benign 0.43
R4936:Zfp786 UTSW 6 47821268 nonsense probably null
R5084:Zfp786 UTSW 6 47820019 missense probably benign 0.00
R5445:Zfp786 UTSW 6 47819685 missense probably damaging 1.00
R6662:Zfp786 UTSW 6 47826986 missense probably damaging 1.00
R7290:Zfp786 UTSW 6 47819995 missense probably damaging 1.00
R7561:Zfp786 UTSW 6 47819733 missense probably benign 0.02
R8038:Zfp786 UTSW 6 47821254 missense probably benign 0.01
R8090:Zfp786 UTSW 6 47820009 missense probably damaging 1.00
R8438:Zfp786 UTSW 6 47820000 missense probably damaging 1.00
R8516:Zfp786 UTSW 6 47820543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTAAGTGAAGCCGCTG -3'
(R):5'- AGTCTGGACTGTGAGGACTG -3'

Sequencing Primer
(F):5'- CAGCTGTCCCTTTTGGCTGAAG -3'
(R):5'- TGTGAGGACTGCTGCCACATG -3'
Posted On2020-07-28