Incidental Mutation 'R4471:Sox5'
ID 329427
Institutional Source Beutler Lab
Gene Symbol Sox5
Ensembl Gene ENSMUSG00000041540
Gene Name SRY (sex determining region Y)-box 5
Synonyms A730017D01Rik
MMRRC Submission 041728-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4471 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 143828425-144781977 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143844765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 523 (M523T)
Ref Sequence ENSEMBL: ENSMUSP00000047567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038815] [ENSMUST00000077160] [ENSMUST00000111748] [ENSMUST00000111749] [ENSMUST00000144289] [ENSMUST00000170367]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000038815
AA Change: M523T

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047567
Gene: ENSMUSG00000041540
AA Change: M523T

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 431 445 N/A INTRINSIC
coiled coil region 449 483 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HMG 555 625 2.84e-26 SMART
low complexity region 686 708 N/A INTRINSIC
low complexity region 729 750 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077160
AA Change: M475T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076403
Gene: ENSMUSG00000041540
AA Change: M475T

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 277 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
coiled coil region 401 435 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
HMG 507 577 2.84e-26 SMART
low complexity region 638 660 N/A INTRINSIC
low complexity region 681 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111746
SMART Domains Protein: ENSMUSP00000107375
Gene: ENSMUSG00000041540

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
coiled coil region 78 112 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HMG 184 234 1.72e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111748
AA Change: M152T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107377
Gene: ENSMUSG00000041540
AA Change: M152T

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
coiled coil region 78 112 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HMG 184 254 2.84e-26 SMART
low complexity region 315 337 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111749
AA Change: M439T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107378
Gene: ENSMUSG00000041540
AA Change: M439T

DomainStartEndE-ValueType
low complexity region 132 143 N/A INTRINSIC
coiled coil region 158 237 N/A INTRINSIC
low complexity region 347 361 N/A INTRINSIC
coiled coil region 365 399 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
HMG 471 541 2.84e-26 SMART
low complexity region 602 624 N/A INTRINSIC
low complexity region 645 666 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141102
Predicted Effect probably benign
Transcript: ENSMUST00000144289
SMART Domains Protein: ENSMUSP00000122786
Gene: ENSMUSG00000041540

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
coiled coil region 127 161 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170367
AA Change: M474T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133041
Gene: ENSMUSG00000041540
AA Change: M474T

DomainStartEndE-ValueType
low complexity region 167 178 N/A INTRINSIC
coiled coil region 193 272 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
coiled coil region 400 434 N/A INTRINSIC
low complexity region 445 456 N/A INTRINSIC
HMG 506 576 2.84e-26 SMART
low complexity region 637 659 N/A INTRINSIC
low complexity region 680 701 N/A INTRINSIC
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to breathe and die at birth exhibiting a narrow thoracic cage, irregularly mineralized sternum, cleft secondary palate, and delayed bone mineralization. Homozygotes for a transposon induced insertion die shortly after birth exhibiting cyanosis and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,571 L212P probably damaging Het
AF067061 G T 13: 120,264,043 R81L probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Ankrd13b T A 11: 77,476,214 K49M probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Cdc34b A G 11: 94,742,238 E88G probably benign Het
Cdh2 T C 18: 16,774,476 probably null Het
Ceacam1 T A 7: 25,474,600 N210I possibly damaging Het
Celf3 A G 3: 94,488,278 probably null Het
Cmya5 A T 13: 93,092,325 M2085K probably benign Het
Cpne6 G A 14: 55,516,632 V469M probably damaging Het
Cyp2j12 A G 4: 96,133,069 V100A probably benign Het
Diexf C T 1: 193,130,137 R5Q possibly damaging Het
Dnajb4 A T 3: 152,185,162 H333Q probably benign Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Eml1 T C 12: 108,506,635 probably benign Het
Ern1 C A 11: 106,420,042 V302L possibly damaging Het
Fam110b A T 4: 5,799,092 H170L probably benign Het
Fn3krp T G 11: 121,426,673 D146E probably benign Het
Git1 A G 11: 77,499,824 T129A probably benign Het
Glrp1 T A 1: 88,503,474 Q58L unknown Het
Gpatch2 A G 1: 187,233,140 E281G probably damaging Het
Hipk2 T A 6: 38,736,922 probably benign Het
Hydin A G 8: 110,587,132 N4214S probably damaging Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Impdh1 G A 6: 29,204,632 Q307* probably null Het
Ivns1abp C T 1: 151,361,239 T447M probably benign Het
Lman1 A T 18: 65,991,726 probably benign Het
Mdn1 A G 4: 32,668,860 E306G probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mtif2 T C 11: 29,540,053 probably benign Het
Mvp C T 7: 127,001,958 M1I probably null Het
Myh7 A T 14: 54,991,854 Y162* probably null Het
Nemf G A 12: 69,314,442 H956Y probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Patj A G 4: 98,535,579 K621E probably damaging Het
Prss2 A G 6: 41,522,846 I24V probably damaging Het
R3hcc1l T C 19: 42,582,820 probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc16a3 T C 11: 120,955,948 probably benign Het
Slc5a4b G A 10: 76,058,891 Q594* probably null Het
Slk T G 19: 47,615,423 V202G probably damaging Het
Smarca2 T A 19: 26,619,877 V53D possibly damaging Het
Snrnp200 T A 2: 127,238,753 V2036E probably benign Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tecrl A G 5: 83,313,287 Y108H probably benign Het
Tln1 A T 4: 43,551,018 F409L probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Ttc23 G A 7: 67,670,156 R187Q probably benign Het
Ttl T C 2: 129,082,057 V230A probably benign Het
Ube2u G A 4: 100,481,646 W36* probably null Het
Ube4a A T 9: 44,946,532 probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc45a A G 7: 80,332,980 I399T possibly damaging Het
Wdr59 A C 8: 111,466,787 probably null Het
Zfp24 A G 18: 24,018,115 probably benign Het
Zfp777 A T 6: 48,042,107 W342R probably damaging Het
Zfp979 A T 4: 147,613,456 C265* probably null Het
Zzef1 T A 11: 72,913,331 L2633Q probably damaging Het
Other mutations in Sox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Sox5 APN 6 144116472 missense probably damaging 0.96
IGL03217:Sox5 APN 6 143907497 missense probably damaging 1.00
Stocking UTSW 6 144116443 critical splice donor site probably null
R0230:Sox5 UTSW 6 144209338 missense probably benign 0.02
R0610:Sox5 UTSW 6 143833439 missense possibly damaging 0.56
R1162:Sox5 UTSW 6 143960812 missense probably damaging 1.00
R1857:Sox5 UTSW 6 143960815 missense probably damaging 1.00
R1959:Sox5 UTSW 6 143874105 missense possibly damaging 0.94
R4057:Sox5 UTSW 6 144116522 missense probably damaging 1.00
R4164:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R4284:Sox5 UTSW 6 143835329 missense probably damaging 1.00
R4430:Sox5 UTSW 6 144041274 missense possibly damaging 0.57
R4470:Sox5 UTSW 6 143844765 missense possibly damaging 0.54
R4672:Sox5 UTSW 6 143833349 missense probably damaging 1.00
R4683:Sox5 UTSW 6 143833467 missense probably damaging 0.99
R4693:Sox5 UTSW 6 143835316 missense probably damaging 1.00
R4735:Sox5 UTSW 6 143960835 missense probably damaging 1.00
R4745:Sox5 UTSW 6 143833488 missense possibly damaging 0.53
R4762:Sox5 UTSW 6 143861383 critical splice donor site probably null
R4996:Sox5 UTSW 6 144028344 nonsense probably null
R5218:Sox5 UTSW 6 143960890 missense possibly damaging 0.93
R5673:Sox5 UTSW 6 144116480 missense probably damaging 1.00
R5856:Sox5 UTSW 6 144209362 missense probably damaging 1.00
R6249:Sox5 UTSW 6 143833283 missense probably benign 0.33
R6394:Sox5 UTSW 6 144041313 missense probably damaging 1.00
R6703:Sox5 UTSW 6 143833465 missense probably damaging 1.00
R6812:Sox5 UTSW 6 144116443 critical splice donor site probably null
R7312:Sox5 UTSW 6 144155033 missense probably benign
R7543:Sox5 UTSW 6 143841179 missense probably damaging 0.96
R8110:Sox5 UTSW 6 144116474 missense possibly damaging 0.92
R8231:Sox5 UTSW 6 144028288 missense probably damaging 0.98
R8250:Sox5 UTSW 6 144155051 missense possibly damaging 0.85
R8705:Sox5 UTSW 6 144041286 missense possibly damaging 0.50
R8937:Sox5 UTSW 6 143907443 missense probably benign 0.00
R9182:Sox5 UTSW 6 143833392 missense possibly damaging 0.51
R9193:Sox5 UTSW 6 143844844 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGACTGCGGTAAATGTGAGC -3'
(R):5'- GTCCAAACCCCTGCTGATTAG -3'

Sequencing Primer
(F):5'- TAAATGTGAGCCCCACTGG -3'
(R):5'- GGTGAATACGCCAATATCCCATGG -3'
Posted On 2015-07-21