Mutagenetix > Incidental Mutation

Incidental Mutation 'R8318:Csgalnact1'

641813

Institutional Source

Beutler Lab

Gene Symbol

Csgalnact1

Ensembl Gene

ENSMUSG00000036356

Gene Name

chondroitin sulfate N-acetylgalactosaminyltransferase 1

Synonyms

CSGalNAcT-1, 4732435N03Rik

MMRRC Submission

067855-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R8318 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68356781-68735146 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68461133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 140 (E140G)

Ref Sequence

ENSEMBL: ENSMUSP00000077459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]

AlphaFold

Q8BJQ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000078350
AA Change: E140G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: E140G

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	55	505	3.5e-85	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.2e-10	PFAM
Pfam:Glyco_transf_7C	409	478	1.7e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000130214
AA Change: E140G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: E140G

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	71	505	1.1e-59	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.6e-10	PFAM
Pfam:Glyco_transf_7C	405	478	3.4e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000136060
AA Change: E140G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356
AA Change: E140G

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	66	300	1.6e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank1	T	C	8: 23,115,551	V1145A	probably damaging	Het
Ankrd35	G	A	3: 96,684,722	V775M	probably damaging	Het
Ankrd63	C	T	2: 118,703,240	V67M	unknown	Het
Arhgef5	T	A	6: 43,275,999		probably null	Het
Atp13a2	A	T	4: 141,007,024	Q1152H	probably benign	Het
Carmil1	A	G	13: 24,036,459	L1094P	probably benign	Het
Col7a1	G	A	9: 108,958,374	A612T	unknown	Het
Ddx18	G	T	1: 121,566,087	A56D	probably benign	Het
Dixdc1	T	C	9: 50,684,409		probably null	Het
Dpys	G	A	15: 39,784,665	T498I	probably benign	Het
Ear6	A	G	14: 51,854,265	I90V	probably benign	Het
Egr1	T	C	18: 34,863,610	S482P	probably damaging	Het
Ehbp1	C	T	11: 22,137,980	R393Q	probably benign	Het
Enpep	A	G	3: 129,270,337	I927T	probably damaging	Het
Ermard	C	T	17: 15,022,072	T406I	possibly damaging	Het
Etl4	T	C	2: 20,788,530	S971P	probably damaging	Het
Fan1	C	A	7: 64,350,055	V861F	probably damaging	Het
Fbp1	A	G	13: 62,865,011	F328L	probably benign	Het
Fgd5	T	A	6: 91,987,496	F237I	probably benign	Het
Fmn1	T	C	2: 113,365,157	S401P	unknown	Het
Gabbr1	G	A	17: 37,062,543	E444K	probably benign	Het
Htr3b	C	A	9: 48,964,877		probably benign	Het
Ighv1-49	A	G	12: 115,055,431	F48S	probably damaging	Het
Kcnh4	A	G	11: 100,752,328	L371P	probably damaging	Het
Kcnk15	A	G	2: 163,858,269	T143A	probably damaging	Het
Klk1b4	T	G	7: 44,210,911	S150A	possibly damaging	Het
Krt6a	A	T	15: 101,694,247	M1K	probably null	Het
Lama2	G	A	10: 26,984,338	S3051L	probably damaging	Het
Lgals4	T	C	7: 28,834,515	M38T	probably benign	Het
Mdn1	T	C	4: 32,735,897		probably null	Het
Mindy1	A	G	3: 95,292,625	S246G	probably damaging	Het
Myo18a	A	G	11: 77,823,389	T770A	probably benign	Het
Olfr1221	T	A	2: 89,111,898	I205F	probably benign	Het
Olfr1254	C	T	2: 89,788,977	C125Y	possibly damaging	Het
Olfr270	T	C	4: 52,971,104	V161A	probably benign	Het
Pcdhb19	T	A	18: 37,497,946	S265T	possibly damaging	Het
Pcna	T	C	2: 132,251,428	Y133C	probably damaging	Het
Polr2b	A	G	5: 77,335,729	E684G	probably benign	Het
Pon2	T	C	6: 5,265,425	I321V	probably benign	Het
Prss54	T	A	8: 95,564,466	M169L	probably damaging	Het
Rps3	T	A	7: 99,483,731		probably benign	Het
Senp1	T	C	15: 98,064,867	D312G	probably damaging	Het
Serpina10	T	A	12: 103,616,848	T446S	possibly damaging	Het
Slc2a5	A	G	4: 150,139,658	D241G	possibly damaging	Het
Slc7a11	A	G	3: 50,417,986		probably null	Het
Tgfbrap1	G	C	1: 43,056,669	C536W	probably damaging	Het
Trip11	C	T	12: 101,912,804	G9S	unknown	Het
Zfp626	C	A	7: 27,818,245	T217K	possibly damaging	Het

Other mutations in Csgalnact1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02025:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02037:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02059:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02074:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02079:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02080:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02094:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02127:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02128:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02157:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02158:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02197:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02201:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02206:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02207:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02214:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02215:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02229:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02243:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02247:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02248:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02250:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02389:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02394:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02397:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02398:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02400:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02404:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02405:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02406:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02420:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02425:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02428:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02436:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02437:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02438:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02468:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02470:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02472:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02473:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02474:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02475:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02510:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02529:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02530:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02531:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02533:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02543:Csgalnact1	APN	8	68461068	missense	probably damaging	1.00
IGL02620:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02625:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02671:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02674:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02683:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02685:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02686:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02697:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02698:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02741:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02985:Csgalnact1	APN	8	68461043	missense	probably benign	0.02
R0173:Csgalnact1	UTSW	8	68461029	missense	probably damaging	1.00
R1594:Csgalnact1	UTSW	8	68358632	missense	probably damaging	1.00
R1655:Csgalnact1	UTSW	8	68373689	missense	possibly damaging	0.89
R1873:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R1955:Csgalnact1	UTSW	8	68372667	missense	probably benign
R2421:Csgalnact1	UTSW	8	68461508	missense	probably benign	0.42
R3195:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3196:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3951:Csgalnact1	UTSW	8	68461262	missense	probably benign
R4304:Csgalnact1	UTSW	8	68372642	missense	possibly damaging	0.94
R4989:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5133:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5134:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5503:Csgalnact1	UTSW	8	68461473	missense	probably damaging	0.98
R5812:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R6143:Csgalnact1	UTSW	8	68373550	missense	probably damaging	1.00
R6387:Csgalnact1	UTSW	8	68358713	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461109	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461110	missense	probably damaging	1.00
R7023:Csgalnact1	UTSW	8	68358429	missense	probably benign
R8446:Csgalnact1	UTSW	8	68461091	missense	probably damaging	0.99
R8519:Csgalnact1	UTSW	8	68401453	missense	possibly damaging	0.65
R8674:Csgalnact1	UTSW	8	68373616	missense	possibly damaging	0.91
R8782:Csgalnact1	UTSW	8	68358655	missense	probably damaging	1.00
R9210:Csgalnact1	UTSW	8	68461589	start gained	probably benign
R9619:Csgalnact1	UTSW	8	68401354	missense	probably damaging	0.99
Z1088:Csgalnact1	UTSW	8	68401330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATGCCAACCTTCTATGAAG -3'
(R):5'- CTAAAGGATGAACTGCAGGCAC -3'

Sequencing Primer
(F):5'- AACCTTCTATGAAGTCTGCAGCTG -3'
(R):5'- ACGCAGTGAGCAGTTCC -3'

Posted On

2020-07-28