Incidental Mutation 'R7926:Gm340'
ID643352
Institutional Source Beutler Lab
Gene Symbol Gm340
Ensembl Gene ENSMUSG00000090673
Gene Namepredicted gene 340
SynonymsLOC381224
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7926 (G1)
Quality Score999
Status Not validated
Chromosome19
Chromosomal Location41582370-41586536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41582569 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 67 (F67S)
Ref Sequence ENSEMBL: ENSMUSP00000128083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172371]
Predicted Effect probably benign
Transcript: ENSMUST00000172371
AA Change: F67S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: F67S

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
Pfam:DUF4553 787 1241 9.7e-179 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
BC016579 C A 16: 45,629,462 D198Y probably damaging Het
Cep170 A G 1: 176,761,413 S549P probably damaging Het
Cnih3 T C 1: 181,450,001 L96P probably damaging Het
Cnn2 T A 10: 79,993,326 L168Q probably damaging Het
Cnot1 ACG A 8: 95,745,647 probably null Het
Cnot10 A G 9: 114,617,815 C398R probably damaging Het
Dcaf4 C A 12: 83,533,929 Y212* probably null Het
Dmxl2 T C 9: 54,428,042 T665A probably benign Het
Dnmt1 C A 9: 20,907,559 A1609S unknown Het
Dzip1 T C 14: 118,883,499 D682G probably benign Het
Fam76a A G 4: 132,902,094 L249P probably damaging Het
Fgf10 T C 13: 118,789,216 M177T probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Hoxa13 CG CGAG 6: 52,260,636 probably null Het
Itln1 G A 1: 171,531,693 T73I probably benign Het
Jkamp T C 12: 72,094,816 Y197H probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lmf2 G A 15: 89,352,421 P514L probably damaging Het
Lmntd2 G T 7: 141,210,345 P610Q probably damaging Het
Map3k3 T C 11: 106,145,722 S225P probably damaging Het
Mbd5 T C 2: 49,256,323 Y182H probably damaging Het
Mki67 A G 7: 135,697,140 V2055A possibly damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myh8 C T 11: 67,278,906 P17L possibly damaging Het
Myt1l T A 12: 29,811,652 D144E unknown Het
Nfatc1 T C 18: 80,697,666 Y373C probably damaging Het
Pacs2 C T 12: 113,060,752 L418F probably damaging Het
Paxip1 A G 5: 27,791,209 I24T unknown Het
Pdcl C T 2: 37,352,237 G167E probably damaging Het
Pdcl A C 2: 37,352,239 S166R probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Qsox1 C T 1: 155,812,787 G5S unknown Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sass6 T A 3: 116,628,770 S641T possibly damaging Het
Six1 T C 12: 73,043,809 N194S probably benign Het
Tagap T C 17: 7,926,938 probably null Het
Tiparp T C 3: 65,553,525 V645A possibly damaging Het
Tm2d2 T C 8: 25,020,464 V113A probably damaging Het
Tmprss6 C A 15: 78,452,850 R352L probably benign Het
Tslp A G 18: 32,817,193 E105G possibly damaging Het
Ttc41 A G 10: 86,776,047 E1093G probably benign Het
Ush2a G A 1: 188,728,600 R2686H probably benign Het
Usp54 A T 14: 20,576,968 Y541N probably damaging Het
Vmn2r125 A G 4: 156,350,693 D122G probably damaging Het
Other mutations in Gm340
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB003:Gm340 UTSW 19 41582569 missense probably benign
BB013:Gm340 UTSW 19 41582569 missense probably benign
R0006:Gm340 UTSW 19 41584899 missense probably benign 0.00
R0686:Gm340 UTSW 19 41582372 missense possibly damaging 0.73
R1104:Gm340 UTSW 19 41586063 missense probably damaging 0.99
R1278:Gm340 UTSW 19 41584683 missense probably benign 0.07
R1606:Gm340 UTSW 19 41585074 missense probably benign 0.35
R1833:Gm340 UTSW 19 41584948 missense probably benign 0.00
R1905:Gm340 UTSW 19 41583574 missense possibly damaging 0.73
R2697:Gm340 UTSW 19 41584027 missense probably benign 0.43
R2881:Gm340 UTSW 19 41583049 missense probably damaging 1.00
R4720:Gm340 UTSW 19 41585895 missense probably benign 0.04
R4864:Gm340 UTSW 19 41585364 missense probably benign
R4908:Gm340 UTSW 19 41584162 missense probably benign 0.00
R5193:Gm340 UTSW 19 41582530 missense probably damaging 1.00
R5215:Gm340 UTSW 19 41585932 missense probably damaging 1.00
R5276:Gm340 UTSW 19 41585039 missense probably damaging 0.98
R5319:Gm340 UTSW 19 41586352 missense probably damaging 0.99
R5321:Gm340 UTSW 19 41585204 missense probably damaging 1.00
R5432:Gm340 UTSW 19 41584603 missense probably damaging 1.00
R5605:Gm340 UTSW 19 41582863 missense probably damaging 1.00
R5941:Gm340 UTSW 19 41586400 missense probably damaging 1.00
R6020:Gm340 UTSW 19 41583547 missense possibly damaging 0.88
R6024:Gm340 UTSW 19 41583957 missense possibly damaging 0.84
R6149:Gm340 UTSW 19 41585202 missense probably damaging 1.00
R6260:Gm340 UTSW 19 41582370 missense probably null 0.91
R6260:Gm340 UTSW 19 41582371 missense possibly damaging 0.73
R6476:Gm340 UTSW 19 41583079 missense probably benign 0.04
R7051:Gm340 UTSW 19 41585752 missense probably benign 0.05
R7285:Gm340 UTSW 19 41584315 missense possibly damaging 0.91
R7372:Gm340 UTSW 19 41585506 missense probably damaging 1.00
R7762:Gm340 UTSW 19 41583667 missense probably benign 0.02
R7833:Gm340 UTSW 19 41584585 missense probably benign 0.02
R8164:Gm340 UTSW 19 41585410 missense probably damaging 1.00
R8319:Gm340 UTSW 19 41582904 missense probably damaging 1.00
R8323:Gm340 UTSW 19 41583597 missense probably benign 0.01
R8327:Gm340 UTSW 19 41582557 missense probably damaging 1.00
R8423:Gm340 UTSW 19 41585449 missense possibly damaging 0.95
X0013:Gm340 UTSW 19 41584532 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTCTGGCTGCAGTGGAAG -3'
(R):5'- GTCTTGATGGAGGCTGACATC -3'

Sequencing Primer
(F):5'- CTGCAGTGGAAGAGGTGGC -3'
(R):5'- ACCATTGGATGCTCTGTGTACAG -3'
Posted On2020-08-07