Mutagenetix > Incidental Mutations

Incidental Mutation 'R7931:Tln2'

643599

Institutional Source

Beutler Lab

Gene Symbol

Tln2

Ensembl Gene

ENSMUSG00000052698

Gene Name

talin 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R7931 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

67217087-67559703 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 67258460 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215267] [ENSMUST00000215784] [ENSMUST00000217550]

Predicted Effect

probably benign
Transcript: ENSMUST00000039662

SMART Domains

Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	3.4e-59	PFAM
Pfam:I_LWEQ	661	765	1.9e-10	PFAM
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	2.6e-67	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2384	2531	2.5e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000040025

SMART Domains

Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	8.5e-78	PFAM
low complexity region	674	693	N/A	INTRINSIC
internal_repeat_2	703	763	2.05e-7	PROSPERO
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	9.9e-72	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2383	2533	4.3e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214859

Predicted Effect

probably benign
Transcript: ENSMUST00000215267

Predicted Effect

probably benign
Transcript: ENSMUST00000215784

Predicted Effect

probably null
Transcript: ENSMUST00000217550

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp2	A	T	2: 91,206,715		probably null	Het
Aire	G	A	10: 78,030,296	A536V	probably damaging	Het
Aox4	A	G	1: 58,255,486	I951M	probably benign	Het
Ash1l	G	T	3: 89,043,541	C2190F	probably damaging	Het
C1s1	C	T	6: 124,533,400	V363M	probably damaging	Het
Col7a1	C	A	9: 108,980,522		probably benign	Het
Coq10b	A	G	1: 55,052,993		probably benign	Het
Diaph3	A	T	14: 87,115,020	D48E	possibly damaging	Het
Dnajc13	A	G	9: 104,218,564	V559A	probably benign	Het
Dzank1	T	C	2: 144,481,694	I610V	probably benign	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Flt1	A	G	5: 147,588,572	S919P	probably damaging	Het
Gm10800	AAGAAAACTGAAAATCAT	A	2: 98,667,034		probably benign	Het
Gm13212	G	A	4: 145,622,556	D188N	possibly damaging	Het
Gria1	A	G	11: 57,310,525		probably benign	Het
Hoxa13	G	GCA	6: 52,260,637		probably null	Het
Igkv4-70	C	A	6: 69,267,991	R82L	probably damaging	Het
Lnp1	T	A	16: 56,927,918	R4*	probably null	Het
Lrrc3b	T	C	14: 15,358,018	N196S	probably benign	Het
Mlxip	A	G	5: 123,450,495	D816G	probably damaging	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Myom3	A	T	4: 135,789,636	H839L	probably benign	Het
Nebl	C	T	2: 17,376,622		probably null	Het
Ninj1	T	C	13: 49,193,956	I99T	probably damaging	Het
Nvl	C	T	1: 181,109,155		probably benign	Het
Olfr1249	T	A	2: 89,630,104	I265F	possibly damaging	Het
Olfr167	A	G	16: 19,515,508	S43P	possibly damaging	Het
Olfr738	A	C	14: 50,414,329	M262L	probably damaging	Het
Olfr972	A	T	9: 39,873,850	T192S	possibly damaging	Het
Otop1	A	G	5: 38,288,020	H174R	probably damaging	Het
Pcdhb16	A	G	18: 37,478,457	N157D	possibly damaging	Het
Prss44	A	C	9: 110,814,678	Q130P	probably damaging	Het
Ptprh	C	A	7: 4,571,988	S344I	probably benign	Het
Rps6kl1	T	C	12: 85,149,792	I33V	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Scn1a	T	C	2: 66,317,812	S110G	probably damaging	Het
Sdk2	C	A	11: 113,893,441	K157N	possibly damaging	Het
Serpina1d	A	T	12: 103,767,556	V163D	probably damaging	Het
Serpina3g	T	C	12: 104,239,169	S56P	probably benign	Het
Slc4a4	T	C	5: 89,170,781	L636P	probably benign	Het
Slc6a1	T	C	6: 114,311,902	F474S	probably benign	Het
Slco6d1	A	G	1: 98,428,416	D235G	probably damaging	Het
Srgn	A	T	10: 62,494,984	M114K	possibly damaging	Het
Syne3	A	T	12: 104,963,232	V243E	probably damaging	Het
Tbc1d5	T	C	17: 50,799,864		probably benign	Het
Tcf19	A	G	17: 35,514,907	F118L	probably damaging	Het
Tnxb	A	G	17: 34,688,698	T1239A	probably damaging	Het
Traip	A	G	9: 107,971,042	I453M	probably benign	Het
Usp5	T	C	6: 124,824,446		probably benign	Het
Vmn1r157	C	T	7: 22,761,785	A30V	probably damaging	Het
Vmn1r233	G	A	17: 20,993,863	A275V	probably benign	Het
Vps13d	G	A	4: 145,096,284	R2976*	probably null	Het
Wdr75	T	C	1: 45,819,635	F655L	probably benign	Het
Wwp1	A	G	4: 19,650,114		probably null	Het
Zc3h4	T	C	7: 16,432,984	L747P	unknown	Het

Other mutations in Tln2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tln2	APN	9	67344187	missense	possibly damaging	0.59
IGL01110:Tln2	APN	9	67250582	nonsense	probably null
IGL01112:Tln2	APN	9	67311811	missense	probably damaging	1.00
IGL01307:Tln2	APN	9	67395467	missense	probably benign	0.25
IGL01374:Tln2	APN	9	67261923	missense	probably damaging	1.00
IGL01625:Tln2	APN	9	67370623	missense	probably damaging	1.00
IGL01865:Tln2	APN	9	67250614	nonsense	probably null
IGL01999:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02002:Tln2	APN	9	67356698	missense	probably damaging	0.98
IGL02005:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02015:Tln2	APN	9	67361439	splice site	probably benign
IGL02368:Tln2	APN	9	67240810	splice site	probably benign
IGL02444:Tln2	APN	9	67258592	splice site	probably benign
IGL02646:Tln2	APN	9	67255996	missense	probably benign	0.43
IGL02744:Tln2	APN	9	67229376	nonsense	probably null
IGL02869:Tln2	APN	9	67221525	splice site	probably benign
IGL02930:Tln2	APN	9	67393662	nonsense	probably null
IGL03100:Tln2	APN	9	67295737	missense	probably damaging	1.00
IGL03326:Tln2	APN	9	67334257	missense	possibly damaging	0.67
BB008:Tln2	UTSW	9	67258460	critical splice donor site	probably null
BB018:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0107:Tln2	UTSW	9	67370706	missense	probably damaging	1.00
R0494:Tln2	UTSW	9	67355197	missense	probably benign	0.22
R0884:Tln2	UTSW	9	67370733	missense	probably damaging	1.00
R0947:Tln2	UTSW	9	67295813	missense	probably benign	0.08
R0989:Tln2	UTSW	9	67229454	missense	probably damaging	1.00
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1486:Tln2	UTSW	9	67311839	missense	probably damaging	1.00
R1527:Tln2	UTSW	9	67272668	missense	possibly damaging	0.95
R1584:Tln2	UTSW	9	67296414	missense	probably damaging	1.00
R1636:Tln2	UTSW	9	67306532	missense	probably damaging	1.00
R1656:Tln2	UTSW	9	67227107	missense	possibly damaging	0.81
R1707:Tln2	UTSW	9	67375807	missense	probably benign	0.00
R1749:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1751:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1761:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1767:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1815:Tln2	UTSW	9	67229423	missense	probably damaging	1.00
R1840:Tln2	UTSW	9	67342043	missense	probably damaging	1.00
R1847:Tln2	UTSW	9	67362687	nonsense	probably null
R1964:Tln2	UTSW	9	67342135	missense	probably benign	0.00
R1968:Tln2	UTSW	9	67255901	missense	probably damaging	1.00
R2036:Tln2	UTSW	9	67272704	missense	possibly damaging	0.76
R2038:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R2152:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2153:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2154:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2191:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2192:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2201:Tln2	UTSW	9	67375757	missense	probably damaging	1.00
R3116:Tln2	UTSW	9	67355139	missense	probably benign	0.10
R3151:Tln2	UTSW	9	67330547	critical splice donor site	probably null
R3795:Tln2	UTSW	9	67255915	missense	probably damaging	0.97
R3953:Tln2	UTSW	9	67370629	missense	probably damaging	1.00
R4450:Tln2	UTSW	9	67344065	critical splice donor site	probably null
R4685:Tln2	UTSW	9	67302572	missense	probably damaging	1.00
R4688:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R4696:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4697:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4700:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4701:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4741:Tln2	UTSW	9	67386555	critical splice donor site	probably null
R4806:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4807:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4808:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4967:Tln2	UTSW	9	67355125	missense	probably damaging	0.97
R5061:Tln2	UTSW	9	67354468	missense	probably benign
R5092:Tln2	UTSW	9	67256028	missense	probably benign	0.13
R5093:Tln2	UTSW	9	67334314	missense	probably benign	0.44
R5126:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R5204:Tln2	UTSW	9	67354482	missense	probably benign	0.00
R5236:Tln2	UTSW	9	67365923	missense	probably damaging	0.99
R5287:Tln2	UTSW	9	67242359	missense	probably damaging	1.00
R5568:Tln2	UTSW	9	67311865	missense	probably damaging	1.00
R5571:Tln2	UTSW	9	67334320	missense	possibly damaging	0.88
R5642:Tln2	UTSW	9	67296358	missense	probably benign	0.01
R5711:Tln2	UTSW	9	67392547	missense	probably benign	0.00
R5776:Tln2	UTSW	9	67258250	missense	probably damaging	1.00
R5791:Tln2	UTSW	9	67386605	missense	probably damaging	0.98
R5866:Tln2	UTSW	9	67266868	missense	probably damaging	1.00
R5888:Tln2	UTSW	9	67229403	missense	probably damaging	1.00
R5902:Tln2	UTSW	9	67362717	missense	probably benign	0.02
R6106:Tln2	UTSW	9	67323020	missense	probably damaging	0.99
R6175:Tln2	UTSW	9	67224081	missense	probably damaging	1.00
R6385:Tln2	UTSW	9	67278129	missense	probably benign	0.45
R6430:Tln2	UTSW	9	67272665	missense	probably damaging	1.00
R6441:Tln2	UTSW	9	67272689	missense	probably damaging	1.00
R6738:Tln2	UTSW	9	67386664	missense	possibly damaging	0.91
R6776:Tln2	UTSW	9	67262905	missense	probably damaging	1.00
R6794:Tln2	UTSW	9	67286558	missense	probably benign	0.07
R6850:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R6907:Tln2	UTSW	9	67397635	missense	probably damaging	0.98
R6909:Tln2	UTSW	9	67392532	missense	probably damaging	0.97
R6951:Tln2	UTSW	9	67258485	missense	probably damaging	0.97
R7015:Tln2	UTSW	9	67362647	missense	possibly damaging	0.55
R7051:Tln2	UTSW	9	67346417	missense	probably benign	0.00
R7246:Tln2	UTSW	9	67262979	missense	probably damaging	1.00
R7292:Tln2	UTSW	9	67346461	missense	probably benign
R7753:Tln2	UTSW	9	67395473	missense	probably damaging	1.00
R7868:Tln2	UTSW	9	67348226	missense	probably damaging	1.00
R8023:Tln2	UTSW	9	67224064	missense	probably damaging	1.00
R8081:Tln2	UTSW	9	67356747	missense	probably damaging	1.00
R8164:Tln2	UTSW	9	67319420	missense	probably benign	0.31
R8192:Tln2	UTSW	9	67346529	nonsense	probably null
R8495:Tln2	UTSW	9	67354467	missense	probably benign	0.01
X0027:Tln2	UTSW	9	67376853	missense	probably damaging	1.00
X0064:Tln2	UTSW	9	67348138	missense	probably damaging	1.00
X0067:Tln2	UTSW	9	67370691	missense	probably damaging	1.00
Z1176:Tln2	UTSW	9	67346485	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GCCTTCACAGTCTTAAGAAGGG -3'
(R):5'- ATGCAGAGACTCCTCCTTCC -3'

Sequencing Primer
(F):5'- CCTTCACAGTCTTAAGAAGGGAGGTG -3'
(R):5'- CCCTGGTAGCAGTCATCAGTGAAG -3'

Posted On

2020-08-07