Incidental Mutation 'R7918:Epha8'
ID648176
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene NameEph receptor A8
SynonymsEphA8, Hek3, Eek
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7918 (G1)
Quality Score190.009
Status Not validated
Chromosome4
Chromosomal Location136929419-136956816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136934566 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 573 (F573L)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
Predicted Effect probably benign
Transcript: ENSMUST00000030420
AA Change: F573L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: F573L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik G A 5: 130,384,428 T30I unknown Het
Adam21 A G 12: 81,560,604 V128A possibly damaging Het
Adam26a T C 8: 43,569,529 Y308C probably damaging Het
Adam26b A G 8: 43,521,101 V288A probably benign Het
Ankrd29 A C 18: 12,295,922 L30R probably damaging Het
Bank1 A G 3: 136,093,362 I406T probably damaging Het
Cacna1g A G 11: 94,444,030 I817T probably benign Het
Catsperd T C 17: 56,631,564 F31L probably benign Het
Cep164 A G 9: 45,779,688 probably null Het
Clca4b T C 3: 144,913,272 Y702C probably damaging Het
Clstn1 A G 4: 149,644,051 I655V probably damaging Het
Dock1 A G 7: 135,145,418 E1486G probably damaging Het
Exoc1 A G 5: 76,543,993 N323S probably benign Het
Exoc6b C T 6: 85,069,350 R19Q probably damaging Het
Gcsam T C 16: 45,620,139 *182R probably null Het
Ighv9-2 T C 12: 114,109,291 I21V probably benign Het
Ints2 G A 11: 86,222,217 T825M probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lad1 A G 1: 135,829,716 T398A probably benign Het
Lrfn2 T C 17: 49,071,184 V431A probably damaging Het
Mast2 T C 4: 116,435,535 I79M possibly damaging Het
Nup107 A G 10: 117,782,000 V171A probably benign Het
Olfr376 T C 11: 73,375,097 F119S probably damaging Het
Olfr888 T A 9: 38,108,807 Y35* probably null Het
Olfr970 C A 9: 39,820,110 T157K probably damaging Het
Pde4dip T A 3: 97,715,223 K1557* probably null Het
Plat C T 8: 22,773,639 P185S probably damaging Het
Plcg1 T G 2: 160,753,665 V511G probably damaging Het
Plxnb3 C T X: 73,767,645 A1258V probably benign Het
Rnf223 T C 4: 156,132,783 V205A probably benign Het
Slc13a1 G C 6: 24,118,066 T224R probably benign Het
Slc39a10 T A 1: 46,835,752 H130L possibly damaging Het
Sucnr1 T A 3: 60,086,369 I106N probably damaging Het
Syde2 T C 3: 146,002,415 probably null Het
Syne1 T C 10: 5,359,078 I644V possibly damaging Het
Tbc1d8 A C 1: 39,402,728 F261C probably damaging Het
Tmem132e A G 11: 82,445,290 Y1066C probably damaging Het
Trip12 A C 1: 84,745,063 I1322S probably damaging Het
Tsnaxip1 A G 8: 105,844,535 I676V probably benign Het
Vmn1r231 A T 17: 20,889,974 Y226* probably null Het
Vmn2r63 G C 7: 42,903,531 A767G probably damaging Het
Wdr5b A G 16: 36,041,822 T104A probably damaging Het
Zbed5 T C 5: 129,901,663 V151A possibly damaging Het
Zc3h7b T C 15: 81,768,988 F31S probably damaging Het
Zfp874b A T 13: 67,474,160 C340S possibly damaging Het
Zmym4 T A 4: 126,911,004 probably null Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R2372:Epha8 UTSW 4 136933010 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5552:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R5830:Epha8 UTSW 4 136936390 nonsense probably null
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R6799:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7826:Epha8 UTSW 4 136936187 missense probably benign 0.09
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8294:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8295:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8445:Epha8 UTSW 4 136932289 missense probably benign 0.13
R8889:Epha8 UTSW 4 136934539 missense probably benign 0.45
R8892:Epha8 UTSW 4 136934539 missense probably benign 0.45
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCATCACGCATGAACTAC -3'
(R):5'- ATGAGTCTAGAACCAAGGCCC -3'

Sequencing Primer
(F):5'- AAGAACCTTTGGCATCCCTCGG -3'
(R):5'- AAGGCCCCTCCTCTTCAGAC -3'
Posted On2020-09-15