Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Epha8'

728900

Institutional Source

Beutler Lab

Gene Symbol

Epha8

Ensembl Gene

ENSMUSG00000028661

Gene Name

Eph receptor A8

Synonyms

EphA8, Hek3, Eek

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

136929419-136956816 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 136938586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 420 (L420M)

Ref Sequence

ENSEMBL: ENSMUSP00000030420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030420]

AlphaFold

O09127

Predicted Effect

probably damaging
Transcript: ENSMUST00000030420
AA Change: L420M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: L420M

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
EPH_lbd	30	203	2.59e-116	SMART
FN3	328	418	4.03e-6	SMART
FN3	439	520	1.67e-12	SMART
Pfam:EphA2_TM	542	631	5.8e-10	PFAM
TyrKc	634	891	1.03e-125	SMART
SAM	926	993	4.74e-19	SMART

Meta Mutation Damage Score

0.1158

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Epha8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Epha8	APN	4	136945810	missense	probably damaging	1.00
IGL00960:Epha8	APN	4	136951839	splice site	probably null
IGL01124:Epha8	APN	4	136936083	missense	probably damaging	1.00
IGL01550:Epha8	APN	4	136931740	missense	possibly damaging	0.87
IGL01807:Epha8	APN	4	136931682	missense	probably benign	0.08
IGL01844:Epha8	APN	4	136931049	makesense	probably null
IGL02167:Epha8	APN	4	136931094	missense	probably damaging	1.00
R0255:Epha8	UTSW	4	136940286	missense	probably damaging	0.99
R0445:Epha8	UTSW	4	136932400	missense	probably damaging	1.00
R1757:Epha8	UTSW	4	136931478	splice site	probably null
R1911:Epha8	UTSW	4	136936314	missense	probably damaging	1.00
R1936:Epha8	UTSW	4	136940243	missense	probably benign	0.08
R2291:Epha8	UTSW	4	136933347	missense	probably damaging	1.00
R2359:Epha8	UTSW	4	136946032	missense	probably damaging	1.00
R2372:Epha8	UTSW	4	136933010	missense	probably damaging	1.00
R4581:Epha8	UTSW	4	136933464	missense	probably damaging	1.00
R4747:Epha8	UTSW	4	136938695	frame shift	probably null
R4784:Epha8	UTSW	4	136933322	missense	probably damaging	1.00
R5156:Epha8	UTSW	4	136938726	missense	probably benign	0.14
R5164:Epha8	UTSW	4	136945672	missense	possibly damaging	0.93
R5335:Epha8	UTSW	4	136931935	missense	probably damaging	1.00
R5480:Epha8	UTSW	4	136935130	missense	probably benign
R5552:Epha8	UTSW	4	136931899	missense	probably damaging	1.00
R5830:Epha8	UTSW	4	136936390	nonsense	probably null
R6017:Epha8	UTSW	4	136931743	missense	probably damaging	1.00
R6450:Epha8	UTSW	4	136931899	missense	probably damaging	1.00
R6798:Epha8	UTSW	4	136945669	missense	probably benign	0.00
R6799:Epha8	UTSW	4	136945669	missense	probably benign	0.00
R7060:Epha8	UTSW	4	136931158	missense	probably damaging	1.00
R7297:Epha8	UTSW	4	136945913	missense	probably damaging	1.00
R7344:Epha8	UTSW	4	136934538	missense	probably benign	0.14
R7467:Epha8	UTSW	4	136931088	missense	possibly damaging	0.90
R7563:Epha8	UTSW	4	136938789	missense	possibly damaging	0.77
R7826:Epha8	UTSW	4	136936187	missense	probably benign	0.09
R7845:Epha8	UTSW	4	136936401	missense	probably benign	0.04
R7863:Epha8	UTSW	4	136933655	missense	probably damaging	1.00
R7904:Epha8	UTSW	4	136931739	missense	possibly damaging	0.95
R7918:Epha8	UTSW	4	136934566	missense	probably benign	0.12
R8177:Epha8	UTSW	4	136945663	missense	probably benign	0.00
R8244:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8266:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8268:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8269:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8289:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8290:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8294:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8295:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8299:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8445:Epha8	UTSW	4	136932289	missense	probably benign	0.13
R8889:Epha8	UTSW	4	136934539	missense	probably benign	0.45
R8892:Epha8	UTSW	4	136934539	missense	probably benign	0.45
R8928:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8965:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8983:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8984:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8988:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9081:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9231:Epha8	UTSW	4	136945915	missense	probably damaging	1.00
R9262:Epha8	UTSW	4	136931684	missense	probably benign
R9370:Epha8	UTSW	4	136946200	missense	possibly damaging	0.94
R9466:Epha8	UTSW	4	136935103	missense	probably benign
R9478:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9546:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9547:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9550:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9585:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9624:Epha8	UTSW	4	136931754	missense	probably damaging	1.00
R9686:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9690:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9744:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9763:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9794:Epha8	UTSW	4	136938724	missense	probably benign	0.16
RF025:Epha8	UTSW	4	136933037	critical splice acceptor site	probably benign
RF054:Epha8	UTSW	4	136933037	critical splice acceptor site	probably benign
Z1176:Epha8	UTSW	4	136938696	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGATGACTGCCTCTGTGTTC -3'
(R):5'- ATCACCTACAACGCAGTGTG -3'

Sequencing Primer
(F):5'- CAGACTGAGTTCTGCTTTCCTATAGG -3'
(R):5'- CAACGCAGTGTGCCGCC -3'

Posted On

2022-10-06