Incidental Mutation 'R7918:Ints2'
ID648197
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7918 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86222217 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 825 (T825M)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: T825M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T825M

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: T825M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T825M

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik G A 5: 130,384,428 T30I unknown Het
Adam21 A G 12: 81,560,604 V128A possibly damaging Het
Adam26a T C 8: 43,569,529 Y308C probably damaging Het
Adam26b A G 8: 43,521,101 V288A probably benign Het
Ankrd29 A C 18: 12,295,922 L30R probably damaging Het
Bank1 A G 3: 136,093,362 I406T probably damaging Het
Cacna1g A G 11: 94,444,030 I817T probably benign Het
Catsperd T C 17: 56,631,564 F31L probably benign Het
Cep164 A G 9: 45,779,688 probably null Het
Clca4b T C 3: 144,913,272 Y702C probably damaging Het
Clstn1 A G 4: 149,644,051 I655V probably damaging Het
Dock1 A G 7: 135,145,418 E1486G probably damaging Het
Epha8 A G 4: 136,934,566 F573L probably benign Het
Exoc1 A G 5: 76,543,993 N323S probably benign Het
Exoc6b C T 6: 85,069,350 R19Q probably damaging Het
Gcsam T C 16: 45,620,139 *182R probably null Het
Ighv9-2 T C 12: 114,109,291 I21V probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lad1 A G 1: 135,829,716 T398A probably benign Het
Lrfn2 T C 17: 49,071,184 V431A probably damaging Het
Mast2 T C 4: 116,435,535 I79M possibly damaging Het
Nup107 A G 10: 117,782,000 V171A probably benign Het
Olfr376 T C 11: 73,375,097 F119S probably damaging Het
Olfr888 T A 9: 38,108,807 Y35* probably null Het
Olfr970 C A 9: 39,820,110 T157K probably damaging Het
Pde4dip T A 3: 97,715,223 K1557* probably null Het
Plat C T 8: 22,773,639 P185S probably damaging Het
Plcg1 T G 2: 160,753,665 V511G probably damaging Het
Plxnb3 C T X: 73,767,645 A1258V probably benign Het
Rnf223 T C 4: 156,132,783 V205A probably benign Het
Slc13a1 G C 6: 24,118,066 T224R probably benign Het
Slc39a10 T A 1: 46,835,752 H130L possibly damaging Het
Sucnr1 T A 3: 60,086,369 I106N probably damaging Het
Syde2 T C 3: 146,002,415 probably null Het
Syne1 T C 10: 5,359,078 I644V possibly damaging Het
Tbc1d8 A C 1: 39,402,728 F261C probably damaging Het
Tmem132e A G 11: 82,445,290 Y1066C probably damaging Het
Trip12 A C 1: 84,745,063 I1322S probably damaging Het
Tsnaxip1 A G 8: 105,844,535 I676V probably benign Het
Vmn1r231 A T 17: 20,889,974 Y226* probably null Het
Vmn2r63 G C 7: 42,903,531 A767G probably damaging Het
Wdr5b A G 16: 36,041,822 T104A probably damaging Het
Zbed5 T C 5: 129,901,663 V151A possibly damaging Het
Zc3h7b T C 15: 81,768,988 F31S probably damaging Het
Zfp874b A T 13: 67,474,160 C340S possibly damaging Het
Zmym4 T A 4: 126,911,004 probably null Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
R7337:Ints2 UTSW 11 86217842 missense probably benign 0.00
R7410:Ints2 UTSW 11 86233226 missense probably benign 0.02
R7483:Ints2 UTSW 11 86215618 missense probably damaging 1.00
R7503:Ints2 UTSW 11 86232055 missense probably benign
R7804:Ints2 UTSW 11 86212663 missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86238263 missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86213062 missense probably damaging 0.99
R7922:Ints2 UTSW 11 86244627 missense probably benign 0.29
R8058:Ints2 UTSW 11 86255353 missense probably benign 0.05
R8134:Ints2 UTSW 11 86212660 missense probably damaging 1.00
R8189:Ints2 UTSW 11 86215570 missense probably damaging 1.00
R8295:Ints2 UTSW 11 86225088 missense probably damaging 0.97
R8348:Ints2 UTSW 11 86255423 missense probably benign
R8448:Ints2 UTSW 11 86255423 missense probably benign
R8784:Ints2 UTSW 11 86222137 missense probably damaging 1.00
R8784:Ints2 UTSW 11 86225115 nonsense probably null
R8942:Ints2 UTSW 11 86212894 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCAGTGGGTTAGAGCAC -3'
(R):5'- CCAGCCTGAAATACATGAGAGCC -3'

Sequencing Primer
(F):5'- TCTGAAGACAGCTACAGTGTAC -3'
(R):5'- CTTAGATGTCAGCTCTAACATAG -3'
Posted On2020-09-15